Q: Using a Punnett Square predict what the Genotypes are for the persons II-3 & II-4.(* C/C or C/A mean…
A: Observing the pedigree chart, the inheritance of the trait is observed as Autosomal recessive…
Q: Why is the process of differentiation essential to specialization? Give an example.
A: Introduction :- Cell specialisation, also known as cell differentiation, is the transformation of…
Q: 6 5 1 Frog Mid-Cleavage 2 .3
A: Introduction The blastula is a hollow sphere of cells, or blastomeres, developed by recurrent…
Q: Herpes simplex virus: describe the molecular detail of how infected neuron cells are able to survive…
A: Viral infections Viruses at yeh the life forms that are inactive until and unless they find a…
Q: Frog Late Blastula 3 10 000. 8 4 11 N
A: Introduction Animal embryonic development, commonly known as embryogenesis, is the stage of an…
Q: Fertilization primarily occurs in the oviduct yet implantation usually occurs in the uterus. Why?
A: Sexual reproduction refers to the form of reproduction that occurs through the union of male and…
Q: QUESTION 4 You are studying pancreatic cancer have matched samples of tumor and healthy pancreatic…
A: Fluorescence is the phenomenon where a material absorbs light at high energy and low wavelength and…
Q: is/are performed by 2. Equation(s) consumers, and equation(s) is/are performed by producers. a. I,…
A: Introduction: All organisms on earth require input of energy from its environment. we know that…
Q: What is a signal sequence, and what is it recognized by? In what cellular process do signal…
A: Signal peptide The N-terminus among most newly produced proteins that are headed for the secretory…
Q: What are the human-caused changes to the Tumucumaque National Park ecosystem? Tumucumaque National…
A: Poaching is uncommon in Tumucumaque because it is so remote and difficult to reach. However,…
Q: There are several forms of allelic genes interaction. At one of the forms a homozygous and a…
A: Gene interactions occur when two or more allelic or non-allelic genes of same genotype influence the…
Q: Why do you think males produce gametes throughout life yet females have a limited timespan? Does…
A: females have a limited reservoir
Q: In mammals, the X and Y chromosomes contain different sets of genes. They are able to pair together…
A: Chromosome are long , thread like structure exhibited inside the nucleus of the cell that contain…
Q: COMPLETE THE FIGURE BY PROVIDING FOR APPROACHES TO VECTOR CONTROL BELOW
A: In the living world, all the animals are in some or other way useful to one another. The same is…
Q: 90-91. Is there any analyte that may be affected given the circumstance? If Yes, choose which…
A: Introduction Phlebotomy is the process of inserting a cannula into a vein, usually in the arm, in…
Q: Which statements are true? Explain why or why not.1 In normal adult tissues, cell death usually…
A: Introduction :- In multicellular organisms, apoptosis is a type of planned cell death. Cell death…
Q: ii) UNDERGROUND STEM ADAPTATIONS Instruction: 1. Match the given photos with the following stem…
A: Introduction Underground stems:- These are modified plants that derive from stem tissue but exist…
Q: a) Microbial products can be classified in three major categories which related to the microorganism…
A: Microbial metabolism defines all the internal bio-chemical pathways, through which microbes obtain…
Q: Explain how changes in your epigenome can alter the DNA of your future children before they are even…
A: Epigenome refers to all of the modifications that regulate the activity of the genes within a…
Q: How is the small intestine designed to absorb digested food ?
A: Introduction :- The duodenum, jejunum, and ileum are the three sections of the small intestine. It…
Q: Which vitamin is important in the conversion of saturated fats to unsaturated fats? O A. Lipoic acid…
A: Saturated and Unsaturated Fats Fats are the lipids or fatty acids that are composed of…
Q: Question 12 Select one answer. A healthy fair-skinned person usually has which color tinted cheeks?…
A: Introduction The skin is the body's largest organ. The integumentary system is made up of the skin…
Q: 1. Explain the X-ray spectrum given in the figure below. Kaz liigu 80 90 Relative output 0 10 20 30…
A: Introduction An X-ray, also known as X-radiation, is a type of high-energy electromagnetic radiation…
Q: A company is given a yearly allowance of carbon emissions it is permitted to release. Due to using…
A: This question can be solved via using rules of economical optimization for the surplus.
Q: 3. Disaccharides a. Draw a lactose molecule b. Label the individual monosaccharide components c.…
A: The disaccharides are made up of the joining two monosaccharides. The disaccharides can be homodimer…
Q: 7. Put these components of the ERK kinase signal transduction pathway in the correct order EEE EGFR…
A: Signalling or adaptor proteins binds to phosphorylated receptors wherein signalers pass signal on to…
Q: Every chimpanzee somatic cell contains 48 chromosomes, in which genes are localized. How many genes…
A: Chromosome are highly condensed, coiled chromatin fibre. Each chromosome is made up of protein and a…
Q: List one similarity and one difference between chemical and mechanical digestion.
A: Mechanical digeation refers as the physical break down of substances into small particle to more…
Q: Define Metabolism: Compare the types below: Anabolic Pathway Catabolic Pathway
A: Introduction A metabolic pathway is a chain of chemical reactions that occur within a cell.…
Q: What is 12 Tissue Remedy in Homoeopathy?.
A: Introduction Dr. Samuel Hahnemann discovered homoeopathy, a type of medical therapies. It is not…
Q: Compare and contrast archaeal and bacterial cell wall structure (peptidoglycan and pseudomurein) in…
A: Introduction A cell wall is a structural layer found just outside the cell membrane that surrounds…
Q: The diagram below shows the bonds within and between three molecules. Of the labeled bonds, which…
A: 2 and 4 are the hydrogen bond . hydrogen bond is a primarily electrostatic force of attraction…
Q: How can the molecular analysis ofan individual tumor be more effectivelyused to design effective…
A: Tumor cells is basically a lump of tissues. These are formed by the abnormal multiplication of…
Q: What are the drawbacks of drawing parallels between nonhuman primate behavior and human behavior?
A: Introduction Primates are eutherian mammals that belong to the Primates taxonomic order. Primates…
Q: Outline the major steps in the process of (indicate necessary enzymes for each): a. Replication…
A: The translation is usually defined as the way that they are been stated to process of creating…
Q: estion Completion Status: You are studying a group of individuals with X-ray vision and perform…
A: Restriction endonucleases These are restriction enzymes that have been isolated from the bacteria.…
Q: A chromatin rearrangement on the EGFR gene promoter An mRNA stabilising protein binding to the 3'…
A: A gene is made up of DNA which is able to synthesizer functional product in the form of RNA or a…
Q: Which one of the following amino acids is essential for humans? A. Threonine B. Alanine C. Aspartic…
A: Introduction Amino acids and proteins are the building blocks of life, they are molecules that…
Q: A substance require by humans in small quantities are
A: Introduction A nutrient is a substance that an organism requires in order to survive, grow, and…
Q: 1. I - Prolonged storage of the specimen for arterial blood gas analysis may have falsely elevated…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Describe the Ti plasmid binary vector system used in plant transformation and provide details of how…
A: Plasmids are small circular double-stranded DNA molecules present in bacterial cells and other…
Q: In amino acid synthesis- C transfers: a-ketoglutarate, serine O tetrahydrofolate, glutamate…
A: Amino acids These are the basic building blocks of proteins. In proteins, amino acid residues are…
Q: Amino acids a. Draw a generalized amino acid b. Label the functional groups that you recognize
A: In this question we have to describe about the structure of amino acid which is a part of protein
Q: Your mitochondrial DNA is not identical to the mitochondrial DNA of your: O sister O father O…
A: The DNA found in mitochondria are small and circular and very much like that of a typical bacterium.…
Q: Which of the following could affect the ability of an enzyme to catalyze a reaction? PH all of these…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Also you have posted graded questions…
Q: Which of the following is not a hypothesis used to describe the sudden change in the diversity of…
A: The term "Cambrian explosion" refers to a time when bilaterally symmetrical (bilaterian) animal…
Q: 4. Explain why molecules of water form hydrogen bonds with other molecules of water.
A: Hydrogen bond has the strong ability to form bonds with other molecules, although they are not…
Q: 13.Write LEFT or RIGHT to indicate the direction of the movement of water in the following cells…
A: Ans- Water movement between the cells is depend on the DPD and diffusion, a process known as…
Q: B. Match the parts of the Nervous System and their functions: 1. Cerebrum 2. Cerebellum 3. Brain…
A: Introduction :- The cerebellum is a structure at the back of the brain that lies beneath the…
Q: Question 22 Select one answer. What features of the papillary layer allow it to protect the body…
A: Introduction Our metabolic system gives us the energy we need to keep our bodies running smoothly.…
The following gel was produced in manual DNA sequencing. What would the unknown DNA template be that this gel represents?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Just part B please!!>TGTCTAGTTGGCAATTGTCCTAGCCATACTGT1 10 20 30 40 50 60 70 -I---- 5' АTCGGTCТCGGCTACTACАТАAАСGCGCGCATATATCGAТАТСТАGСТАGСТАТCGGTCTAGGCTACTАC 3' TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG I--------I--- --I--- --I------ --I--- -I---------I Promoter 80 90 100 110 120 130 140 -I---- 5' CAGGTATсGGTCTGATCTAССТAGCTTCTтсттстстстстсссссGCGGGGGCTGTACTATСATGCGTCG 3' GTCCATAGCCAGACTAGATCGATCGAAGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC -I- -I------- -I--- -I---------I RBS 150 160 170 180 190 200 210 -----I--- ---I-- ------I- ---I---------I---- -I---------I 5' тстCGGCTАСТАCGTAAACGCGCGCATATAтCGATATCTAGCТAGСТАТСGGTстCGGCTACTAсGTAAA 3' AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT 220 230 240 250 --I----- ---I-- ------I--- -I 5' CCCTATTAGCATGGGTCATATTTGTGTCTGCTTGTTGGGT 3' GGGATAATCGTACCCAGTAGAAACACAGACGAAGAACCCA a. What are the nucleotides of the MRNA from gene Z? b. What are the amino acids encoded by gene Z? ( Vate V
- Pls answer this question thanksHindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5' CCTAG - G 3' 5' AGAATTCTTACGCCGGACGTACCTAGGTTTAGTCGACTC CGCCGCCCCTAGGGTCATCA 3' 3' TCTTAAGAATGCGGCCTGCATGGATCCAAATCAGCTGAGGCGGCGGGGATCCCAGTAGT 5' Number of pieces of DNA , and blunt end fragment (s), and sticky end fragment(s)