The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
- The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below.
DNA sequence:
5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’
3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’
mature mRNA:
5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’
In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?
The transcription is intended to generate an RNA copy of the DNA sequence for the gene. The RNA transcript provides the required information in respect of a protein-coding sequence for the production of a polypeptide. Until translation in protein, eukaryotic transcripts need to be processed in many ways. Pre-mRNAs are first wrapped in RNA stabilizing proteins, protecting pre-mRNAs from degradation when extracting and exporting them from the nucleus and further processing involves many steps.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images