The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!

Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN:9781305251052
Author:Michael Cummings
Publisher:Michael Cummings
Chapter9: Gene Expression And Gene Regulation
Section: Chapter Questions
Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...
icon
Related questions
Topic Video
Question
The coding DNA strand of a gene has the following
DNA sequence:
5' ATGGCGACGATAATGTTGTGTGAGTGA 3'
1) Find the sequence of the MRNA that would be
made from this gene.
2) Find the amino acid protein sequence that would
be made from this gene
3) A mutation occurs at position 17 of the coding DNA
strand, where the Tis substituted with A (count from
5' end of coding strand). Write the resulting mRNA
and protein sequences. Show all your work!
Transcribed Image Text:The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps with 1 images

Blurred answer
Knowledge Booster
Mitochondrial mutations
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning