A small section of mRNA codons has the following sequence:UGG GAA ACC UUCSome Amino AcidsAspartateGlutamateGlutamineIsoleucineThreonineMethionineAsparagineTryptophanPhenylalanineThe amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.

Name: A small section of mRNA codons has the following sequence:UGG GAA AC
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A small section of mRNA codons has the following sequence:UGG GAA ACC UUCSome Amino AcidsAspartateGlutamateGlutamineIsoleucineThreonineMethionineAsparagineTryptophanPhenylalanineThe amino acids listed above that are coded by the mRNA codons are An

Protein synthesis is a major process inside our body .Our body has complex system for protein…

Answered: The amino acids listed above that are…

Science

Biology

The amino acids listed above that are coded by the mRNA codon

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.4: Translation

Problem 3C: A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon...

See similar textbooks

Some Amino Acids

Aspartate
Glutamate
Glutamine
Isoleucine
Threonine
Methionine
Asparagine
Tryptophan
Phenylalanine

The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.
Record your answer in order from left to right codons.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

This question refers to the mRNA sequence below: 5'-AGCUG AUGGGCUGGUGCCGAGAAAGUUAGGUA A-3' What is the name of the third amino acid in the protein formed from this mRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.
A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1. Valine 2. Serine 3. Proline 4. Glycine 5. Arginine 6. Leucine 7. Histidine 8. Cysteine 9. Glutamine The amino acids listed above that are coded by the MRNA codons are , and Record your answer in order from left to right codons.
This question refers to the mRNA sequence below: 5'-AGCUGAUGGGCUGGUGCCG AGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from this MRNA? Fill in the blank with the correct amino acid name, but nothing else so that Moodle can grade this question correctly.
This question refers to the mRNA sequence below: 5'-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' What is the third amino acid in the protein formed from this mRNA? Fill in the blank with the name of the correct amino acid and nothing else so that Moodle can grade your question correctly.
This question refers to the mRNA sequence below: 5-CCGUAUGCAUUUCGGACUUAGUAAGGACUGACAUAA-3' As this mRNA is translated, the sixth codon is Fill in the blank with the correct codon without any spaces, and nothing else, so that Moodle can grade your question correctly.
The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of glutamate during translation of a hemoglobin chain. Using the table of codons below, determine the mutation in DNA that produces this disorder. 1st position ✓ U C A G Select one: U C serine phenylalanine phenylalanine serine leucine serine leucine serine leucine leucine leucine leucine isoleucine isoleucine isoleucine methionine Table of mRNA Codons 2nd position valine valine valine valine proline proline proline proline alanine alaninc alanine alanine A tyrosine tyrosine a. CUC changes to C AG b. GAA changes to GUU c. CTT changes to CAT d. C A G changes to CTC stop stop threonine asparagine threonine asparagine threonine threonine histidine histidine arginine arginine glutamine arginine glutamine arginine lysine lysine G cysteine cysteine stop tryptophan aspartate aspartate glutamate glutamate serine serine arginine arginine glycine glycine glycine glycine 3rd position DCMO U С A G U C A G…
The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine Threonine
The chart can be used to determine the amino acid that a specific codon encodes. Finl Second Letter Thind Letter U с A G phenylalanine serine tyrosine cysteine U phenylalanine serine U tyrosine cysteine с leucine serine stop stop A leucine serine slop tryptophan G leucine proline histidine arginine U leucine proline histidine arginine с leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine C isol cine threonine arginine A (start) lysine lysine threonine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine C valine alanine glutamate olycine A valine alanine glutamate glycine G If a strand of DNA had the sequence GACTTC, then mutated to be GACATC, what sequence of amino acids would be formed? Aspartate and phenyalanine become apartate and isoleucine Leucine and lysine become leucine and tyrosine Aspartate and phenyalanine become aspartate and methionine Leucine…
A small section of mRNA codons has the following sequence:UGU GGU CAA CCG Some Amino Acids Valine Serine Proline Glycine Arginine Leucine Histidine Cysteine Glutamine The amino acids listed above that are coded by the mRNA codons are Answer, Answer, Answer, and Answer.Record your answer in order from left to right codons.
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA: GTATACCAGTCATTTGTCThen list in order the amino acids coded by this sequence.mRNA ________________________________________________________________amino acids ________________________________________________________________ 2. Sometimes a mistake occurs in the translation of an mRNA strand. Suppose that the reading of themRNA strand in question 1 began, by mistake, at the second nucleotide instead of the first. The first codonwould be AUA. Write the sequence of amino acids that would be formed.__________________________________________________________________________
Table 8.2 Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU O nonsense Oleucine Refer to Table 8.2. UAU codes for which amino acid? O lysine O alanine Phenylalanine UAU leucine UAA alanine lysine valine UCG, UCU O tyrosine AAU UGC tyrosine nonsense asparagine cysteine serine