SUBPHYLUM CRUSTACEA Describe the joint motion of the crayfish cheliped (first walking leg). Compare and contrast the range of motion to that of your own wrist. Describe how the leg structure of the crayfish is modified to compensate for the limited motion of a single joint. EXERCISE

SUBPHYLUM CRUSTACEA Describe the joint motion of the crayfish cheliped (first walking leg). Compare and contrast the range of motion to that of your own wrist. Describe how the leg structure of the crayfish is modified to compensate for the limited motion of a single joint. EXERCISE

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter9: Joints

Section: Chapter Questions

Problem 12ILQ: Watch this video (http://openstaxcollege.org/l/hipjoint1) for a tutorial on the anatomy of the hip...

See similar textbooks

Related questions

Q: How does the hormone glucagon affect glycogen degradation, glycolysis, and TCA cycle? Explain the…

A: Glucagon is the antagonist to insulin and increase glucose concentration in the blood.

Q: Which statement concerning vasopressin secretion is NOT true? Group of answer choices Vasopressin…

A: Vasopressin It is also known as antidiuretic hormone, and it controls the circadian rhythm or the…

Q: HS IP: FLAG-KDM3A SIA - WT + Lane Number: 1 2 3 S/D 4 5 6 Stat1 FLAG

A: KDM3A phosphorylation after 30 or 60 minutes of heat shock at 42°C (heat shock (HS) is generally…

Q: II. Cultural characteristics of yeasts. Below is the colony diameter for each yeast culture grown on…

A: Yeasts are single-celled, eukaryotic microorganisms that belong to the fungal kingdom. There are…

Q: explain the evaluation criteria that would be used to check for the goodness of your solution to the…

A: There are a few important points about Ebola Virus : They belong to the virus of Filoviridae, virus…

Q: 8. In alley cats, the coat color is determined by a gene carried on the X chromosome. Genotypes and…

A: Introduction The term "genotype" refers to an organism's whole gene pool, or, in other words, the…

Q: You have two DNA samples. Only one was expected to have plasmid DNA that was isolated from it. Both…

A: Since only one out of two samples has plasmid DNA. The sample with DNA of other forms can be…

Q: Ihsan is a biologist working with the genetics of a psychrophilic bacterium. He cloned an antifreeze…

A: A gene is the basic physical and the functional unit of heredity. They are made up of DNA. Some…

Q: How are ATP and NADH similar? OA. Both molecules are oxidized by molecular oxygen (O2) in reactions…

A: ATP- Cells consume and store energy from adenosine triphosphate (ATP), which is the energy source.…

Q: Which of the structures highlighted in the image contains a transverse flagellum?

A: Protists are unicellular eukaryotes. They lack the tissue level of body organization and have cilia…

Q: CONCEPT APPLICATION 3. Imagine you are painting your bedroom at home. You get tired of repeatedly…

A: Introduction Skeletal muscles, often known as muscles, are parts of the vertebrate muscular system…

Q: What are the advantages of using genetically encoded calcium markers over other calcium markers?…

A: Ca2+ is a pervasive intracellular messenger that controls various cellular processes in many organ…

Q: Which is the most important digestive enzyme in gastric juice

A: The most important digestive enzyme in gastric juice is pepsin. Gastric juice is formed in the…

Q: What is the major difference in the functions performed by the conventional PCR and real time PCR?…

A: PCR REAL TIME PCR A technique to amplify a segment of DNA , generating millions of copies of a DNA…

Q: Examples of ionizing radiation that are able to damage DNA and kill bacteria are Microwaves and…

A: Bacteria Or microbial pathogens can be killed by gamma ray, Ultraviolet rays, Radiowaves of…

Q: Does increasing amylase production alleviate the symptoms of lactose intolerance? Why or why not?

A: Lactose sugar is present in the milk. So people with lactose intolerance cannot tolerate milk and…

Q: he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in…

A: Given: The sequence of the alpha-2 globin of the human hemoglobin gene cluster found in chromosome…

Q: In the cell wall staining experiment of Bacillus megaterium, what color can you find in a) cell…

A: Introduction: In biology, staining is done to draw attention to particular structures so that living…

Q: List human input-output channels and discuss briefly about it.

A: A human interacts with the outside world through sending and receiving information, often known as…

Q: The postgraduate student, Jocelyn, transformed her gene of interest into two different vectors;…

Q: Why do some types of signal molecules (first messengers) need to use second messengers to cause a…

A: Introduction :- The cell releases intracellular signalling molecules known as second messengers in…

Q: Select the correct word for each of the three boxes in the text below. The biological process that…

A: Cellular respiration is a process by which organisms breakdown food materials inside the cells to…

Q: How does the digestive system of a nematode or annelid differ from that of a flatworm? In what ways…

A: Animals are eukaryotic structure, containing numerous cells , with absence of cell wall . Phylum…

Q: Bacterial cell walls are largely made of peptidoglycan, which is a O monomer, carbohydrate O…

A: Introduction :- Most bacteria's cell wall is made of peptidoglycan, also known as murein, an amino…

Q: Adenine Cytosine Deoxyribose DNA DNA helicase DNA polymerase Double helix Lagging strand Leading…

A: DNA structure formation

Q: 39. Describe each of the 3 factors that influence internal respiration and their significance.…

A: Internal respiration also known as cellular respiration which take place inside the body in tissue.…

Q: What is the type of inheritance? What is known of the genotype of the male in the above cross? What…

A: Introduction Genetics is frequently used to refer to heredity, which is the passing on of genetic…

Q: What two important characteristics allow us to identify a cell in interphase?

A: An active living cell undergoes two major phases - the mitotic phase where the cell divides into two…

Q: A) Identify the structures that would be found in proteins B) identify the structures that…

A: Introduction Large biomolecules and macromolecules known as proteins are made up of one or more…

Q: If radio-labeled C-2 of glucose is used for glycolysis and alcoholic fermentation, which carbon in…

A: Glycolysis It refers to the cytoplasmic pathway that converts glucose into three carbon-containing…

Q: Solution I: 50 mM glucose, 25 mM Tris-Cl (pH 8.0), 10 mM EDTA (pH 8.0) Solution II: ??? Solution…

A: Judging by the Chemical reagents used in the protocol ,it is alkaline lysis method of Plasmid…

Q: Intracellular "wood chippers" known as break down proteins into component parts (peptides) so that…

A: MHC stands for major histocompatibility complex proteins. These are present on the surface of…

Q: Polymerase chain reaction (PCR) is a technique that enables multiplication of specific DNA sample at…

A: The polymerase chain reaction (PCR) was hugely successful in molecular biology. PCR tests are…

Q: A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two…

A: The episomal vectors are the plasmid constructions that replicate in both eukaryotic and prokaryotic…

Q: How does Frequent wakefulness during sleep limits the sleep status in older people? Please…

A: introduction : Adults frequently experience sleep difficulties, which can be attributed to a variety…

Q: A Transporter A Transporter B B Transporter C O Transporter D C D Electrochemical gradient: Which…

A: Sodium-dependent glucose cotransporters, also known as sodium-glucose linked transporters (SGLT),…

Q: is energy is released when ATP loses a phosphate group true about ATP and ADP

A: ATP is the energy currency of the cell and is made up of adenine and ribose sugar with three…

Q: Determine if the cells in prophase of mitosis are haploid or diploid.

A: Mitosis is divided into four stages: prophase, metaphase, anaphase, and telophase. The longest phase…

Q: Besides plants, animals could also be genetically engineered. Describe TWO (2) transgenic fishes…

A: Transgenic animals are animals that carry a foreign gene. These genes are deliberately introduced…

Q: If you analyze the leaf content of a cactus in the early morning hours, what do you expect to find?…

A: The metabolic pathway by which mainly the members of the family Crassulaceae assimilate carbon,…

Q: Q6.10. For a population containing 70 females and 30 males, what is the effective population size,…

A: Evolution is a steady phenomenon that cause transformation of life form from much simple to more…

Q: BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design…

A: It is required to use oligonucleotide primers while conducting a PCR reaction. Designing primers…

Q: For questions 1-3, suppose that in generation 0, the frequency of allele A1 in a population of…

A: Introduction The relative frequency of an allele (gene variant) at a certain locus in a population…

Q: Determine if the cells in telophase I of meiosis are haploid or diploid.

A: Telophase I is a phase observed in the process called meiosis. Meiosis or reductional division is…

Q: Which phase of the cardiac cycle has the largest influence on the Frank-Starling mechanism? systole…

A: Introduction : The cardiac cycle is the series of events that take place throughout each heartbeat,…

Q: The principal genomic component isolated from equine influenza virus is 22% C, 23% A, 22% G and 33%…

A: Introduction Genetic material is the portion of a cell that contains the genetic information that…

Q: homology modelling and such are available free online. State the functions of CLUSTAL W, BLAST and…

A: Numerous computational methods are used in bioinformatics, that include sequence and structural…

Q: How can we determine whether predation is controlling the size of a population? What are the…

A: There is basically inter specific competition type of interaction that exist between prey and…

Q: Which is the most important digestive enzyme in gastric juice?

A: Introduction The food you eat has to be broken down by digestive enzymes. These proteins hasten the…

Q: Convert to cDNA and add linkers

A: This is the High-throughput sequencing that has become the revolutionary technique for the…

Concept explainers

Animal Phylogeny

Cladistics is a method of biological classification where organisms are classified based on their ancestors and their relationship with them. It is defined as the concepts and methods for determining the branching patterns of evolution and evolutionary history. Some scientists, however, have preferred the term phylogenetic systematics or phylogenetic taxonomy to emphasize the reliance on a phylogeny for classification. It is the most common and accepted method for classifying organisms.

Question

REPORT SECTION
Name:
Day & Hours of Lab Section:
SUBPHYLUM CRUSTACEA
Describe the joint motion of the crayfish cheliped (first walking leg). Compare and contrast
the range of motion to that of your own wrist.
Describe how the leg structure of the crayfish is modified to compensate for the limited
motion of a single joint.
BSC20110
v. 20231
EXERCISE

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

× 1:42 iny907-my.sharepoint.com + Info DI × Pre-Lab Activities A. INTRODUCTION Fill in the blanks of the following sentences to describe the study of joints. A joint (or connects a with another or a tooth. The science that studies joints is called the study of musculoskeletal movements is called whereas B. CLASSIFICATION OF JOINTS Joints can be classified according to their structure (i.e. how adjacent bones are bound to each other) or their function (i.e. how much the joint moves). 1. Fill in the table below with the structural classification of joints (e.g. osseous tissue, collagen, cartilage, membrane with slippery fluid). Type of Joint Bones bound together by > bony fibrous cartilaginous synovial 2. Fill in the table below by describing the functional classification of joints (e.g. freely movable, slightly movable, little or no movement). Type of Joint synarthrosis amphiarthrosis diarthrosis Mobility at the Joint 154 C. STRUCTURE OF A SYNOVIAL JOINT 1. Label the figure on the right…
SUSSIOH.Masteringaandp.com/myct/itemView?assignmentProblemID=171858658 sM Gmail O YouTube O Maps Week 6- 3275.12.. Grammarly HW Lab Coaching Activity: Muscles of the Vertebral Column, Abdomen, and Pelvis Submit Part B - Abdominal muscle layers There are four layers of muscles wrapped around the abdominal region. These muscles collectively provide support and protection for the abdominal organs. Three of the layers originate in the lumbar region and come halfw A patient arrives at the ER with a knife stuck on the lateral side of the abdomen. List, in order, the muscle layers the knife went through. > View Available Hint(s) Reset Help Internal oblique Transverse abdominis External oblique Deep Superficial O The correct ranking cannot be determined. Submit
Give typing answer with explanation and conclusion 8. The radiocarpal joint is an example of a Condyloid joint?
Lab 12.pdf 154 C. STRUCTURE OF A SYNOVIAL JOINT 1. Label the figure on the right with the terms in the box. Ligament articular cartilage joint (articular) capsule fibrous capsule synovial membrane cavity containing synovial fluid Proximal phalanx D. TYPES OF SYNOVIAL JOINTS 1. Fill in the table with the six types of synovial joints Synovial Joint Name Middle phalanx Location(s) in the Body Axes of Rotation (describe the movement)
Drag the labels onto the diagram to identify the structural types of articulations. Reset Help Synchondrosis Symphysis Suture Synostosis Gomphosis Syndesmosis
arch Remaining Time: 1 hour, 15 minutes, 24 seconds. Question Completion Status: 1 20 3 4 50 6 80 9 10 11 12 13 14 15 16 28 29 30 QUESTION 24 When an organism shifts from a quadriped to a biped, over time what happens to the spine? 1. The spine shifts from an "S" shape to a "C" shape. 2. The spine connects to the pelvis at an angle. 3. The spine shifts from a "C" shape to an "S" shape. 4. The spine inserts at the back of the femur. QUESTION 25 What was the Piltdown Hoax? O 1. A paleoanthropological fraud in which bone fragments were presented as the fossilised remains of a early human 2. Rumors about bed pillows made from the Pillsbury doughboy 3. The discovery of "Flatface Man" by Maeve Leaky 4. The discovery of "Lucy" by Donald Johanson Click Save and Submit to save and submit. Click Save All Answers to save all answers. T hp O IT fg 144
Watch this animation (http://openstaxcollege.org/l/elbowjoint1) to learn more about the anatomy of the elbow joint. What structures provide the main stability for the elbow?
× 1:42 iny907-my.sharepoint.com Info K DI D. TYPES OF SYNOVIAL JOINTS 1. Fill in the table with the six types of synovial joints Synovial Joint Name Location(s) in the Body Axes of Rotation (describe the movement) E. KNEE (TIBIOFEMORAL) JOINT 1. Label the figure of the knee joint below with the terms in the box. Femur Fibula anterior cruciate ligament (ACL) posterior cruciate ligament (PCL) lateral (fibular) collateral ligament lateral condyle of the femur medial condyle of the femur Tibia medial (femoral) collateral ligament patellar ligament (cut) medial and latelar menisci articular cartilages K 155 G 13
StudentVUE Perioc Block 1-Math Nearpod: Make ev X A app.nearpod.com/presentation?pin3DNW6D9 Question 1/5 Motion can be described by all of the following except... speed. B. direction. C. size. answerls selec
130 LAB 6 EXERCISE 6-8 Label the following: tadres Stylnidarocess Radial bead * Radial tuberosity. Uina Olecranon Trechlearotch Curonoid process Styloid.pocess" Carpals * Scaphoid Lunate* Triquetral* Pisiform* Trapezium * Trapezoid * Capitate* Hamate. Metacarpals Phalanges proximal* middle * distal Pollex 50lecranon 10 distal Radius Head 6troaniear noth Radial Laberosty 11 middle 19 kor onaid. process Broximal Podiust LIna 13 Met 20 14amate 21 15riquetrgh capitate 22 16isiform Arapezda 17 Lunate 23 4 Styloid Drocoss trapazicm 18 24 Frocess Scaphoid License: Anatomy & Physiology Lab Homework by Laird C. Sheldahl, under a Creative Commons Attribution-ShareAlike License 4.0 International
ems Fill-in (give the correct term for each item below; hint: remember to consider anatomical position as needed for determining directional terms) 1. The head is _?_ to the feet. 2. The liver is part of the _?_ system. 3. A leg amputation is likely to involve a ?_ cut, or section, through bone.upi 4. My lower back, or ?_, is sore. 5. The first finger is ?_ to the hand. 6. The popliteal vein is found in the _?_. 7. The heart is _?_ to the right lung. 8. The shoulder is ?_ to the elbow. 9. The skin is _?_ relative to the skeleton. 10. Adipose tissue is often just _?_ to the skin. 11. An occipital scar is on the back of the _?_. Sketch (make a rough sketch of a human figure in the position indicated by the anatomical compass rosette and label) R-
Watch this video (http://openstaxcollege.org/l/kneejoint1) to learn more about the anatomy of the knee joint, including bones, joints, muscles, nerves, and blood vessels. Which ligament of the knee keeps the tibia from sliding too far forward in relation to the femur and which ligament keeps the tibia from sliding too far backward?