sequences below to determine what type of mutation has occurred by comparing the normal sequence to the mutated sequence. Normal Gene Sequence: 3'- ATAGCTAAGCCCATGCGG-5'
Q: Assume the energy of hydrogen bonds per base pair solution at 319 K. ratio - 283
A: 9.8.2016 Cresawn BIO 140 The Chemistry of Life I. Ionic Bonds a. So different, that electrons are…
Q: Which of the following substances requires a transport protein in order to cross a membrane? Select…
A: The transport proteins are the channel protein that makes the specialised pores in the membrane for…
Q: The graph below shows the results of a FRAP analyses studying Membrane Protein 1-4 (MP1-MP4). Work…
A:
Q: Which structures in the central nervous system have a role in the body's voluntary movement? Discuss…
A: The central nervous system (CNS) and the peripheral nervous system (PNS) are the two primary…
Q: self-help group for individuals with eatin
A:
Q: 4. Name the phase of the cell cycle each of the labeled cells is likely in. A B F D E Copyrighe 2008…
A: Cell cycle or cell division refers to the series of events that take place in a cell leading to its…
Q: Eye color in Drosophila is determined by a gene is on the X chromosome, with the red-eye allele…
A: Each gene possesses two forms of alleles. These forms include a dominant allele and a recessive…
Q: Give one chromosome and show its value after mutation - 8 Quean problem
A: Chromosomal mutation is an unpredictable changes occurs in chromosome. It occurs either changes…
Q: In Labrador Retrievers, coat color is determined by one gene with two alleles. The B allele produces…
A: This question is based on genetics.
Q: The human heart is A) Neurogenic heart B) Myogenic heart O C) Pulsating heart D) Ampullary heart
A: The correct option is B - Myogenic heart.
Q: Suppose in a strain of soybeans, high oil (H) content in the seeds is dominant to low oil content…
A: ANSWER;- Given, In a strain of soybeans, the high oil content phenotype in seeds is dominant (H…
Q: Assuming independent assortment for all gene pairs, what is the probability that a parent with the…
A: Given: Genotype of the parent - AABbCc. Considering the genes separately, Probability that the…
Q: Question 6 The opsin responsible for detecting light that entrains the circadian clock is Rhodopsin…
A:
Q: Construct a cladogram of five indoor plants.
A: * A cladogram is a diagram that shows the ancestral relationships among organisms. * Earlier days…
Q: Select all of the statements that are FALSE abou RNA. Consists of ribose sugars O Forms helices O…
A: Ribonucleic acid, or RNA is one of the three major biological macromolecules that are essential for…
Q: What is the procedure of controlling the opening and closing of the stomatal pores?
A: The opening and closing of the stomata are controlled by the factors listed below:
Q: The picture shows bacteria (Escherichia coli) under a microscope Do you bacterial growth or no (…
A: Culture media are an integral part of microbiology lab where bacteria can be grown on different…
Q: metaphase G1 anaphase S interphase G2 prophase M Go telophase cytokinesis
A: A cell cycle is a series of events that takes place in a cell as it grows and divides.
Q: Based on the figure, Identify the following: 1. Producers 2. Primary Consumers 3.…
A: Food chain is a diagrammatic representation that show how animals are dependent on plants for their…
Q: How reliable does the rbcL gene work as a barcode for identifying plant species?
A: * DNA barcoding is method to identify a species by using a short section of DNA. They will compare…
Q: If a diploid population includes 700 A alleles and 300 B alleles for a given locus, what is the…
A: * Hardy Weinberg equilibrium states that allele frequency and genotype frequency in a population…
Q: codon and anticodon
A: A codon is a sequence of three nucleotides or triplets present on mRNA, which encodes for a specific…
Q: In Sickle Cell Anemia, the production of both of the A and S beta-globin peptides in carriers…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: In Labrador Retrievers, coat color is determined by one gene with two alleles. The B allele produces…
A:
Q: In eukaryotes, the regulatory inputs have been amplified compared to prokaryotes, and a typical gene…
A: In eukaryotes, the process of the flow of genetic information of DNA into forming a functional…
Q: What condition is shown in the diagram? Explain how the body regulate this process.
A: The homeothermic animals always maintain a constant core body temperature. They have homeostasis…
Q: Which of the following protein domains would you expect to find in an "easily druggable" target b…
A: * protein domain is a part of protein sequence and tertiary structure that can function and evolve…
Q: Ablack heterozygous female mouse mates with a black male mouse of an unknown genotype. Out of her…
A: Male must be heterotzygous Bb
Q: A particular flower can be purple, blue, red or white. Two purple F1 plants are crossed to produce…
A: Flower can be any of given color, purple, blue, red or white :-
Q: esigner O
A: Desired Trait - Spider silk Donar organism - Golden orb weaving spiders (Nephila clavipes)…
Q: How skeletal system help in maintaining homeostasis?
A: Homeostasis is maintaining the internal , physical and chemical envirinment of the body . This is…
Q: 6) In fruit flies, red eyes are dominant (E). White eyes are recessive (e). If the female fly has…
A: If only one copy exists, dominant characteristics are always produced when the linked allele is…
Q: Would this be considered coagulase positive or negative? The media did not solidify but there was a…
A: Coagulase test Coagulase refers to an enzyme formed by microbes that converts the fibrinogen to…
Q: basic procedure of genetic engineering
A: Genetic engineering is the process of using recombinant DNA technology to alter the genetic makeup…
Q: What is the effect of treatment of CER cells with chloroquine? Explain.
A: General Concepts Clinical Manifestations Rabies virus causes acute infection of the central nervous…
Q: Create a chart like the one below. Write other examples of positive and negative feedback. Use a…
A: Physiological processes are commonly moderated via two distinct feedback mechanisms –positive and…
Q: If you wanted to prepare only one PCR reaction, how much of each reagent would you add to the PCR…
A: Standard PCR reagents include a set of appropriate primers for the desired target gene or DNA…
Q: true/ false Drosha and Pasha bind to mRNAs allowing the 43S subunit to form, but they inhibit the…
A: Drosha is a type III RNase, which plays a critical role in miRNA biogenesis. Pasha is an essential…
Q: Assume an individual is of genotype FfGg, with the genes on different chromosomes. The principle of…
A: Mendel's law of segregatiom states that - During gamete formation , each gene seperates from each…
Q: Definition, classifications and application of polymeric biomaterials.
A: ANSWER) Polymeric biomaterials are the materials or substances which can be used in the body in…
Q: you visited a forest in North America and a forest in Japan at the same latitude (same climate) what…
A: There will be striking similarites in same latitudes are considered as following. Indigenous mammals…
Q: Нуpertonic Isotonic Нуpotonic H,0 H,O H,O HO
A: The capacity of a solution around a cell to influence the cell to lose or gain water is known as…
Q: In one of Mendeks dihybrid crosses of peas, he observed 300 full green pods, 85 constricted green…
A: Chi-square test is the test of significance of overall deviation square in the observed and expected…
Q: Please talk about the Different stages at which modification of DNA, mRNA, and protein is possible.
A: The DNA to protein pathway is the mechanism that permits the cell to produce one of the most…
Q: In the breeding season, male Anole lizards court females by bobbing their heads up and down while…
A: The data given below is the answer
Q: The Cystic Fibrosis receptor (CFTR) is a transmembrane protein that functions as an ion channel…
A: In which compartment, the folding defect occurs in case of Delta 508 mutation in CFTR.
Q: Hello, please answer the following Microbiology question correctly. *If you solve the question…
A: Pasteurization was created by Louis Pasteur, who also accomplished some of the earliest research…
Q: ammonium chloride on the infection of CER cells'
A: Cells were incubated for various hours of time after virus attachment with ammonium…
Q: Complete the Punnett square below for the following cross: RrSu/su X Rrsu/su Punnett square RSu Rsu…
A: Punnett square Punnett square is a square shaped diagram showing genotype of a perticular cross.
Use the sequences below to determine what type of mutation has occurred by comparing the normal sequence to the mutated sequence.
Normal Gene Sequence: 3'- ATAGCTAAGCCCATGCGG-5'
Mutated Gene Sequence 3'-ATAGCTAAGCCCAGGTGCGG-5'
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTa. The reading frame DNA sequence is b. The mRNA sequence is c. The polypeptide sequence is a.The mutated polypeptide sequence is b.What kind of mutation was produced?Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA Mutated – CCU-GAU-GAG-UGA* Please choose one correct answer only A. Missense B. Nonsense C. Silent D. Frameshift
- Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:Choose from : insertion with frameshit, deletion with frameshift, silent mutation, deletion without frameshift, missense mutation, insertion without frameshift, nonsense mutation The wildtype sequence of a gene is the following: wt: 3' TAC AAA TCT AGC CCG 5' and the following 3 mutations were found:, indicate what type of mutation this is 1: 3' TAC AAA TCA AGC CCG 5' ; 2. 3' TAC AAA TCT ATC CCG 5'. ; 3. 3' TAC AAA AGC CCG 5'. ;Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…
- Match the relationships to the corresponding concepts. Expanding nucleotide repeat..... Somatic mutation Base substitution Transition Missence mutation Nuetral mutation Mutation Germline mutation Transversion Silent mutation Indels Frameshift mutation Nonsense mutation Inherited change in DNA sequence Loss of function mutation Gain of function mutation Insertions Deletions Reading frame Answer Bank involving the number of repeat sequences often lead to if removes function alteration of single nucleotides are often alter the alters sense codon to stop codon substitution of unlike base alters the amino acid in protein insertions and deletions of sequences are based on type of tissue, can be does not alter function substitution of like base defined as does not alter amino acid in protein if gains functiona. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?Assume that a mutation occurs in the gene that encodes each of the following RNA polymerases. Match the mutation with its possible effects by placing the correct letter or letters in the blanks below. There may be more than one effect for each mutated polymerase. A mutation in the gene that codes for E RNA polymerase I RNA polymerase II RNA polymerase III Possibleeffects a. tRNA is not synthesized b. Some ribosomal RNA is not synthesized c. Ribosomal RNA is not processed d. pre-mRNA is not processed e. Some mRNA molecules are not degraded f. pre-mRNA is not synthesized
- The figure shows the position of two of these mutations a and b. The nucleotides are altered in these 2 different swo-1 mutant alleles. Use the genetic table to describe any AA changes.Name the type of mutation and describe its effect on swo-1 mRNA and protein for each of the mutations. 3. The swo-1 a mutation (insertion between C and G). 4. The swo-1 b mutation (C-to-T mutation for indicated C). 5. The swo-1 a mutation leads to worms with more body wall muscle, whereas worms with the swo-1 b mutation are not able to move. Based on these phenotypes and the findings from questions 3 and 4, describe the role thewild-type version of this protein plays in muscle function.Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…Sickle-cell hemoglobin differs from regular hemoglobin in just one amino acid. Normal hemoglobin is created from the codon GAA, which codes for glutamic acid while sickle-cell hemoglobin has the codon GUA, which codes for valine. This is an example of what type of mutation? * O Insertion O Silent mutation O Deletion O Substitution mutation