Answered: Select all that apply. The Klenow…

Name: Select all that apply. The Klenow fragment:has primase activity.is an
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Select all that apply. The Klenow fragment:has primase activity.is an E. coli DNA polymerase fragment.has exonuclease activity.is RNA-dependent DNA polymerase.has polymerase activity.

Science

Biochemistry

Select all that apply. The Klenow fragment: has primase activity. is an E. coli DNA polymerase fragment. has exonuclease activity. is RNA-dependent DNA polymerase. has polymerase activity.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 6QP: Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel,...

See similar textbooks

Similar questions

Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
Select the CORRECT pairing. DNA polymerase I : links Okazaki fragments together DNA helicase : unwinds both strands of DNA Primase : removes RNA primer DNA ligase : synthesizes DNA primer
Translesion synthesis (TLS) polymerase zeta (ζ) is capable of accurately reading through 6,4-photoproducts (cytotoxic damage). If this protein is non-functional: a different TLS polymerase will accurately read through the DNA lesion. a different TLS polymerase will inaccurately read through the DNA lesion resulting in increased mutational frequency. the replicative polymerase will inaccurately read through the DNA damage. DNA polymerase alpha (α) will be recruited to synthesize a primer across the DNA damage. the DNA lesion cannot be bypassed and will result in double stranded DNA breaks.
Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bank
Choose the right combination of components required to set up a polymerase chain reaction from the following: Template RNA, two primers, NTPs, and DNA polymerase Template DNA, two primers, dNTPs, and DNA ligase Template DNA, two primers, NTPs, and DNA ligase Template DNA, two primers, dNTPs, and DNA polymerase
Select the characteristics/descriptions of DNA polymerase. Select ALL that apply requires a primer adds nucleotides to 3' end of DNA strand adds nucleotides to 5' end of DNA strand does not require primer has 3'-to-5' exonuclease activity that allows "proofreading" of DNA strand being made
Polymerase chain reaction is—   a reaction involving a chain of different types of polymerases acting successively on a DNA. a way DNA replicates in the living cell. governed by the Henderson-Hasselbalch equation. a chain reaction mediated by polymerase to amplify DNA fragments of defined sequence. DNA polymerization without a template.
Fill in the blank spaces below with the most appropriate terms. The word bank is not provided. DNA replication in bacterium Escherichia coli begins at a site in the DNA called At the replication fork, the strand is synthesized continuously while the strand is synthesized discontinuously (in fragments). The new DNA strand, which is synthesized discontinuously, initially consists of short DNA pieces that are called A short RNA primer at the beginning of each of the DNA fragments is synthesized by an enzyme called and this RNA primer is later removed by the enzyme called using its activity. Single-strand breaks (nicks) that are left behind in this process are sealed by the enzyme called A Moving to another question w!l save this resporse Quebon 4 In
Choose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase I
The image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicases, primase, DNA polymerase III, DNA polymerase I, and ligase. Also, be sure to indicate the 5' and 3' ends of all nucleic acid polymers.
Rank from the first to the last steps in DNA synthesis. Reset H DNA polymerase DNA strands separate as the enzyme helicase unwinds them DNA polymerase catalyzes the covalent addition of free nuclectides to the growing new DNA strands The enzyme primase builds ANA primers on the existing DNA strands Two identical doutle helices First Last
Compare and contrast the properties of DNA polymerase and RNA polymerase. Drag the appropriate items to their respective bins. can proofread using a 3'-to-5' exonuclease activity polymerize in a 5'-to-3' direction Only RNA can initiate strand synthesis catalyze phosphodiester bond formation to polymerize nucleotides into nucleic acids Only DNA use deoxyribonucleotide triphosphates as substrates can only extend an existing strand Both Reset Help dependent on a DNA sequence template use ribonucleotide triphosphates as substrates