Q3: Area of a circle Write a MIPS32 Assembly program that prompts the user for the radius of a circle. Calculate and display the circle's area. Use the syscall procedures to read and print floats. Use Pl as : 3.14159265359
Q: The memory location at address 00002001 contains the memory variable. What is the data memory…
A: Here in this question we have given memory data with their memory address..and we have asked that…
Q: What are the key differences between a hard disc drive and a solid-state drive? How do the two…
A: First, let's discuss both of the drives: HDD (Hard Disk Drives): HDDs are used for data storage and…
Q: We put a piece of software through its paces by executing it and analyzing its instructions to…
A: Black Box Testing: Black Box Testing is a software testing process that examines the functionality…
Q: What are two database design issues that arise while developing Web-based applications?
A: As per the question statement, We will discuss two database design issues that arise while…
Q: In PHP, how do you connect to a MYSQL database?
A: Given: MySQL is the most used open source relational database management system (RDBMS). It adheres…
Q: What exactly does it mean when it comes to cloud computing to have scalability? Do the properties of…
A: Introduction: Here we are required to explain what exactly does it mean when it comes to cloud…
Q: Write pseudo code and design flowchart that reads in three numbers and writes them all in sorted…
A: Input a Input b Input c If a>b If a>c If b>c Print a,b,c Else Print a,c,b Else Print c,a,b…
Q: Are there any pins on the connections for floppy drives? How much information can be saved on a…
A: A floppy disc drive (FDD), also known as a floppy drive, is a hardware device that reads information…
Q: 12.4-2 For the ternary channel in Fig. P12.4-2, Px (x1) P, Px(x2) = Px (x3) = Q. (Note: P+2Q = 1.)…
A:
Q: In class, you gained an understanding of the many means by which software may be made available,…
A: Actually, given information regarding While in class you were introduced to the varieties through…
Q: This is due to the enormous capability of computers nowadays. Are there any explanations for the…
A: Given: We must stress the significance of computers in our educational system and why they are so…
Q: In PHP, how do you connect to a MySQL database?
A: PHP is a widely-used, open source scripting language.
Q: what is Cyborg epoch that is focusing on capability
A: what is Cyborg epoch that is focusing on capability
Q: List any six (6) distinct versions of Windows Server and explain how each one may be installed and…
A:
Q: Take a look at the cutting-edge in computer-generated 3-D imagery. Is creating photo-realistic 3-D…
A: Photo-realistic 3-D graphics present a number of challenges: Make sure the client's expectations are…
Q: l description of a file
A: Solution - In the given question, we have to find the differences between logical description of a…
Q: When it comes to the components that make up a computer, what exactly is the difference between its…
A: answer is
Q: The acronym "Global System for Mobile Communications" (GSM) describes what the system is all about.…
A: answer is
Q: A TCP/IP stack is what it sounds like.
A: Answer the above question are as follows
Q: When looking to purchase a portable computer, what are the most important considerations to make?…
A: Answer
Q: Educate these stakeholders on the advantages of a spreadsheet solution and the simplicity with which…
A: Microsoft Excel is a spreadsheet program available for Windows, macOS, Android, and iOS. It has math…
Q: Find out the key distinctions between a constructor and a method.
A: Constructor and Methods are both defined in a class in Java.
Q: In systems integration initiatives, how do we analyze and develop system infrastructures and…
A: Given: In software development, a variety of models are employed. They resemble the…
Q: A Go-Back-N (GBN) ARQ scheme has been designed with window-size W = 10 such that it is fully…
A: Given that, In Go-Back-N ARQ scheme, Window size w= 10 Frame size= 20,000 bits There are no errors…
Q: Carrier sense multiple access (CSMA) allows a host to access multiple channels. True False
A: The above question that is given above is answered below step
Q: Explain why virtual machines are
A: Q) Explain why virtual machines are important in today's network environment. Answer: virtual…
Q: What is meant by the terms "hardware" and "software"
A: In Step 2, I have provided some points about hardware and some points about…
Q: For this reason, today's computers are so powerful. For what reasons and with what data can we back…
A: Given: For this reason, today's computers are so powerful.For what reasons and with what data can we…
Q: in C language implement a smallest last ordering for the vertices in a graph
A: Code:- int smallest_last_ordering(int n, int m, int *U, int *V, int *adj) { int *deg =…
Q: uted to the evolution of computer security into cu
A: Introduction: Below the describe which factors have contributed to the evolution of computer…
Q: What are some of the advantages of adopting 3D printing technology in the field of computer science?
A: If you need to accelerate the development of your product, creating more content is a great…
Q: Provide a definition for and an explanation of buses and regulators, including the different types,…
A: Deification: What exactly are duties and roles? The term "role" refers to a person's position in a…
Q: It's becoming easier and easier to use web-based software like Google Docs and Microsoft Office.…
A: let us see the answer:- INTRODUCTION:- Web-based software is software that you use using a web…
Q: Who is responsible for the design of the device drivers that are used by an operating system?
A: A device driver is a computer program that operates or controls a particular type of device that is…
Q: The acronym "Global System for Mobile Communications" (GSM) describes what the system is all about.…
A: Given: Below, I explain the answer in my own words so that you can fully get it. Advanced cellular…
Q: Differentiate between manually matching transactions and Advanced Mode transactions in QuickBooks…
A: Introduction: Bank feeds can be set up and managed in a variety of ways. After obtaining your…
Q: Which data model excludes the many-to-many link between entities? What are the benefits and…
A: Document-oriented database data model excludes the many-to-many link between entities. You can…
Q: ndows 7 that only suppo
A: Introduction: Below the version of windows 7 that only supports 32-bit computing
Q: What does the acronym WSDL, or Web services Description Language, stand for, and what is its…
A: Given: The linguistic framework for the explanation of web services (WSDL)The phrase "Web Services…
Q: Using an appropriate software development life-cycle model, specify and design a software…
A: Given: SDLC is a precise prepare for building computer programmes that ensures the quality and…
Q: What are some of the physical components that make up a rigid disc drive?
A: Answer the above question are as follows:
Q: d explain the 3 types of CS
A: Introduction: Below the types of CSS CSS (Cascading vogue Sheets) could be a style-sheet language…
Q: a set of edge (E). Dra
A: Solution - In the given graph, we have to draw the directed graph.
Q: ective risk mitigation strateg
A: Introduction: Below are the most effective risk mitigation strategies for cloud migration
Q: The new properties of cloud computing are highlighted, along with the significance of such qualities…
A: Scalability is considered as a quality attribute. It is a non-functional property of a system that…
Q: Software Engineering Question: Consider the elements of your system. Examine the styles and patterns…
A: Answer
Q: When looking to purchase a portable computer, what are the most important considerations to make?…
A: Given: When looking to purchase a portable computer, what are the most important considerations to…
Q: The term "dependent entity" refers to an entity whose existence is contingent upon that of another…
A: Dependent entities: At the other end of the identifying connection are dependent entities. They…
Q: RDBMS vs. NOSQL: what's the difference?
A: The answer of this question is as follows:
Q: What are the key differences between processes and threads in the field of computer science?
A: A simple definition of a process is an executable program. Multiple threads execute within the…
Step by step
Solved in 3 steps with 1 images
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…(Numerical) Using the srand() and rand() C++ library functions, fill an array of 1000 floating-point numbers with random numbers that have been scaled to the range 1 to 100. Then determine and display the number of random numbers having values between 1 and 50 and the number having values greater than 50. What do you expect the output counts to be?When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error message
- (Statistical) In many statistical analysis programs, data values considerably outside the range of the majority of values are simply dropped from consideration. Using this information, write a C++ program that accepts up to 10 floating-point values from a user and determines and displays the average and standard deviation of the input values. All values more than four standard deviations away from the computed average are to be displayed and dropped from any further calculation, and a new average and standard deviation should be computed and displayed.1. Read input 5 integer values from the user and print them in the reverse order of their input using a stack data structure. Programming languages allowed: C++/JAVA/PythonUsing C++ Program: A palindrome is a word that is spelled the same way both forwards and backwards. For example, the word, 'racecar' is a palindrome. Using character arrays, write a program that prompts the user to enter a word from the keyboard and informs the user whether the word is a palindrome or not.
- C++ Programming Language: Enhance the code given by outputting: The largest number of the sequence a0 ,a1 ,a2 , ..., ak. The position of the largest number Test your program for the following values of x: 75, 111, 678, 732, 873, 2048, and 65535. Example: "For example, for the input sequence: 75, 226, 113, 340, 170, 85, 256, 128, 64, 32, 16, 8, 4, 2, 1, the program output should contain the following: The largest number of the sequence is 340 The position of the largest number is 4" Code Given: #include <iostream> #include <iomanip> using namespace std; int main() { long x; int count; long a_n; cout << "Enter a nonnegative integer: "; cin >> x; cout << endl; count = 0; a_n = x; cout << a_n << ", "; while (a_n !=1) { if (a_n %2==0) a_n = a_n / 2; else a_n = 3 * a_n + 1; count++; cout << a_n <<", "; } cout << endl; cout << "The integer k such that a_k = 1 is " << count << endl; return0; }Code write () 9.Stack using C++ programmijng language please Write a program to input an arithmetic expression, then 1. Match nested brackets found the expression, if they are matched correctly proceed to step 2.2. Evaluate the expression. Please not that the operands of the expression may contain more than one digit. just 3 function : 1.function to check the brackets 2.function from infix to postfix 3.function to evaluate the expression this is the cin of the arithmetic expression is : ((5+(6/2*3)-2)+1)= you can use this function also ::: struct node { int data; node *next; node(int d,node *n=0) { data=d; next=n; } }; class stack { node *topp; public: stack(); void push(int el); bool pop(); int top(); bool top(int &el); //~stack(); //void operator=(stack &o); //stack(stack &o); }; stack::stack() { topp=0; } void stack::push(int el) { topp=new node(el,topp); } bool stack::pop() { if(topp==0) return false; node *t=topp; topp=topp->next; delete t; return true; } int stack::top() {…
- Stack using C++ programmijng language please Write a program to input an arithmetic expression, then 1. Match nested brackets found the expression, if they are matched correctly proceed to step 2. 2. Evaluate the expression. Please not that the operands of the expression may contain more than one digit. just 3 function : 1.function to check the brackets 2.function from infix to postfix 3.function to evaluate the expression this is the cin of the arithmetic expression we will use : ((5+(6/2*3)-2)+1)= this will give you 13 and will go to next stage (5+(6/2*3)-2)+1)= this will give you missing open bracket ((5+(6/2*3)-2)+1= this will give you missing close bracketYou are given a binary array containing only 0's and 1's. You have to sort the array and you can swap any elements in the array. Write a C++ program to find the minimum number of swaps required to sort the array. Input the array and its size from the user and display the minimum number of swaps in the output.Computer Science QuestionIn input you are provided with two words of the same length. Each word contains only lower-case alphabets. A shift operation will remove the first character of a word and add the same character at the end of that word. Your goal is to develop a python program that outputs the number of shift operations required on the second word to maximize the length of the longest common prefix of both the words.Test Case:5ccaddbddccOutput:3