Product(wrong) Substrate(wrong) Ku+ nil Ꮩw . IVW Pre-translocation ky+ ky+ KIV+ / niv Err* k₁. ky-nG ባ,ባባwn v Err*KII- (1-Err) KII- (1-Err) K₁- ky. Vr Pre-insertion (wrong IIIW km-ni Err*k₁+ II (1-Err) Kı+ KIV- (1-i,)kn+ km- i,*kn+ Post-translocation
Q: Describe the intracellular, biochemical downstream signal cascade that results from the binding of…
A: The somatosensory system uses transient receptor potential melastatin 8 (TRPM8) channels to detect…
Q: Chloroplast features I. can synthesize store both carbohydrates and some forms of lipids II.…
A: Introduction Photosynthesis is one of the process through which the plants obtain energy. It is…
Q: . Where is this gene location in the bacterial genome? . What is the length of the gene? . Obtain…
A: Salmonella is usually found in the Gastrointestinal tracts of mammals
Q: 17.During an experiment study of oxyge consumption in the kidney, experimental animals are…
A: Introduction Kidneys are the major excretory organs found in Humans. They are bean shaped and…
Q: What are misfolding diseases? Please explain what causes them. Please name one misfolding disease
A: Proteins are composed of some 20 types of amino acid residues, and they would be more or less alike…
Q: What is a common characteristic of hunter-gatherer societies? cooperative behavior enforced by males…
A: Hunter-gatherer culture is a type of subsistence lifestyle that relies on hunting and fishing…
Q: 1. The body-cover trait displays an extranuclear maternal inheritance pattern. The alleles for this…
A: Extrachromosomal genes, besides DNA-encoded genes, can be found in organelles besides the nucleus,…
Q: 8. Assuming two skeletal muscle fibers have the same myosin ATPase activity, and both are producing…
A: Isotonic contraction :- During isotonic contraction of muscle, same tension maintained while the…
Q: Bacterial Culture Bacterium 1 Pure Culture? Before Cryopreservation Yes No After Cryopreservation…
A: Pure culture is defined as a laboratory culture that contains just one species of organisms in…
Q: Briefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e.,…
A: DNA It is a polymer made of two polynucleotide chains that wound around one another to create a…
Q: Which mRNA sequences would form a structure that is a cue for transcription termination of some…
A: Transcription termination occurs when a transcribing RNA polymerase releases the DNA template and…
Q: What do factors such as water depth and age have to do with the classification of seaweeds?
A: Seaweed, any of the red, green, or brown marine algae that grow along seashores. Seaweeds are…
Q: The +1 site is located in the... Select an answer and submit. For keyboard navigation, use the…
A: DNA is the genetic material of living organisms. It is made up of two chain-like molecules that are…
Q: Place the following events that occur during glucose homeostasis in the correct order by dragging…
A: * Homeostasis is a self regulating process in which an organism can maintain its internal stability…
Q: Endocytosis results in the production of a) a vesicle with a single membrane b) an organelle with…
A: The carrier & channel proteins transport small molecules through the phospholipid bilayer.…
Q: describe the role of fossils in historical biogeography
A: Fossils square measure the preserved remains, or traces of remains, of ancient organisms. Fossils…
Q: Which of the four basic tissue types (connective, epithelial, nervous, or muscle) is involved in…
A: Introduction :- Solid tumours called carcinomas are the common. They are the most prevalent cancer…
Q: A medicine has a clearance of 200 ml/min and a volume of 100 L. After a day, it is decided to double…
A: Steady-state concentration (Css) occurs when the amount of a drug being absorbed is the same amount…
Q: What is the pathway of a protein secreted from the cell. The protein is N-linked with glycosylation…
A: The proteins are synthesized by the translation process that is performed by the ribosome. This…
Q: Which of the following statements about quorum sensing are true? Choose the best answer only. Quorum…
A: The qurum sensing is a very important signal in pathway in bacteria that helps in communication…
Q: Redraw the phylogenetic tree for Cnidarians showing only the relationships between Scyphozoa,…
A: Phylogenetic tree is a branched diagram which shows the evolutionary relationship of organisms. Here…
Q: Draw a diagram illustrating how latent heat flux is driven by humidity gradients between the inside…
A: Eddy diffusion theory This theory is also called the flux-gradient theory. This theory gave the…
Q: There are many similarities between the process of photosynthesis and the process of cellular…
A: Mitochondria It is also known as power house of the cell. It performs the process of respiration and…
Q: V. Pathologic pseudostratified columnar epithelium: Bronchitis Histologic abnormality features: ●…
A: *Celiac disease also called as gluten sensitive disease. It is caused due to immune reaction to…
Q: If the chi-square value came out to 14,224.221 and the p-value was said to be less than 0.01, what…
A: P value P value or probability is use to accept or reject the null hypothesis.
Q: How certain proteins could recognize the specific sequences with the common B-form DNA
A:
Q: This molecule: is contained in the thylakoid membranes of chloroplasts converts sunlight energy…
A: Introduction :- The oxygenic photosynthesis photochemical and electron transport reactions take…
Q: Which steps below require an ATP to run? Phosphorylation Isomerization Second Phosphorylation…
A: ATP is the energy currency of the cell. It is formed during cellular respiration and is used by…
Q: Determine the diversity of the animal community in the pond using the Shannon Diversity Index.…
A: Species richness is the number of animal species in the pond animal community. Species diversity is…
Q: The genome relatedness of different organisms can be shown with a phylogenetic tree constructed…
A: Introduction : A phylogenetic tree is a diagram that shows the relationships between living things…
Q: Please describe the characteristics of a phospholipid molecule. Where is the molecule found?
A: Phospholipid is a class of lipid molecule that is very important structural part of the cell in both…
Q: Question 13, Three of following terms/phrases are generally used to describe a situation when the…
A: Age, sex, marital status, race, ethnicity, religion, and socioeconomic position are all crucial…
Q: Please explain how the catabolism of ATP supports the anabolism of protein.
A: *Catabolism the the process of breakdown of complex molecules into simpler forms and releases…
Q: can you Explain in 1000 words, the role of sewage treatment in hospitals?
A: The operation of a sewage remedy plant approach that you could have one hooked up nearly anywhere,…
Q: IV. Pathologic simple columnar epithelium - Celiac Disease DRAW WITH LABELS GIVEN BELOW ● Columnar…
A: Columnar Epithelium in Celiac Disease: Please find the attachment.
Q: The sequence of the complementary strand of 5' GTCTATAGAC 3' is_____________ Is there anything…
A: Introduction: Since nucleic acids are long-chain polymeric polymers with nucleotides serving as the…
Q: Draw the following epithelial tissues below and specify which part of the human body can it be…
A: Pseudostratified columnar epithelia are tissues formed by a single layer of cells that give the…
Q: In Drosophila yellow body color is caused by a sex-linked recessive allele and brown eye color is an…
A: Linkage is a phenomenon in which genes are exhibited on the same chromosome instead of another…
Q: What changes in Radiation Protection criteria led to the use of Equivalent dose and Effective dose…
A: Radiation dose is measured as the amount of radiation exposure. There are three kinds of dose…
Q: In the process of Oogenesis in animal cells, will the genotype of the second polar body (derived…
A: The process of ova formation also referred to as the formation of female gametes, is characterized…
Q: What is the diversity of Pond Animal Community B? O 0.2 0.32 O 1.0 1.6
A:
Q: The human hormone insulin causes liver cells to increase the rate they convert glucose to glycogen…
A: The answer is option d. The insulin hormone increase the conversion of glucose to glycogen as it…
Q: The body of a man contains 49.5 L of water. He drinks 0.5 L of pure water. Suppose that all of this…
A: Introduction :- The number of osmoles of solute per litre of solution is the unit of measurement for…
Q: What is the difference between cause of death and mannere of death?
A: Introduction: Any death that necessitates examination that is ambiguous or remotely questionable is…
Q: 3. What are the main differences between Linus Pauli proteins that led to his Nobel Prize in…
A: 3 rd Question Linus pauling discovered that- The denaturing of proteins was the result of breaking…
Q: New Tab a…
A: The retina of the vertebrae's eyes contains the interconnecting laterally placed neurons in their…
Q: What is the purpose of alternative splicing a. Alternative spiicing allows a protein to be included…
A: RNA splicing is the process of removal of introns(non coding sequences) from newly made mRNA…
Q: ntify: ic type of stele"
A: The plant kingdom contains all the plants on the earth. Plants are multicellular and the cells have…
Q: Outline the functions of the following hormones in relation to digestion and/or the maintenance of…
A: Introduction In order to be absorbed into the watery blood plasma, large, insoluble food molecules…
Explanation of each route, please
Step by step
Solved in 2 steps
- Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .What would happen if you changed the anticodon in the Tryptophan tRNA from ACC to AAC? First letter U C A G U UUU Phe UUC Phe UUA Leu UUG Leu CỰU Leu CUC Leu CUA Leu CUG Leu AUU lle AUC lle AUA lle AUG Met GUU Val GUC Val GUA Val GUG Val Second letter C A UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala UAU Tyr UAC Tyr UAA Stop UAG Stop CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu G UGU Cys UGC Cys UGA Stop UGG Trp CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg GGU Gly GGC Gly GGA Gly GGG Gly O Tryptophan would be incorporated into peptides where leucine normally goes Tryptophan would be incorporated into peptides where it normally goes ○ Leucine would be incorporated into peptides where Tryptophan normally goes O Histidine would be incorporated into peptides where Leucine normally goes U C A G U C A G U C A G U C A G Third letter
- Genetic Code-Reference Second Letter First Letter C Third Letter UAU] UACS **UAA Stop UGU] Cys UGC U UUU Phe UUC UCU Туг UCC U Ser UUA) Leu UUG **UGA Stop UGG Trp UCA UCG **UAG Stop CUU CCU CAU) CGU His CACJ CAA) CUC CCC CGC Leu Pro Arg CUA ССА CGA A Gln CUG CCG CAGJ CGG AAU] AGUSer U AUU ACU AACAsn AAA Lys AUC Ile ACC AGC C Thr AGA] Arg AUA ACА AAGJLYS GAU] GACASP *AUG Met/Start ACG AGG U GUU GCU GGU Asp GUC GCC GGC Val Ala Gly GAA) Glu GAGJ GUA GCA GGA GUG GCG GGGExplain TWO (2) differences between two commonly used ligases; F. coli DNA ligase and T4 DNA ligase.Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the fragments generated with each treatment. Determine the original sequence for both fragmentations (reduerde that they must be equal in the order of amino acids) Quimotripsina 1. Leu-His-Lys-Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly-Pro-Ser 1. Gln-Gln-Ala-Gln-His-Leu-Arg-Ala-Cys-Gln-Gln-Trp 2. Arg-lle-Pro-Lys-Cys-Arg-Lys-Phe Trypsin 1. Arg 2. Ala-Cys-Gln-GIn-Trp-Leu-His-Lys 3. Cys-Arg 4. Gln-Ala-Asn-Gln-Ser-Gly-Gly-Gly- Pro-Ser 5. lle-Pro-Lys 6. Light 7. Phe-Gin-Gln-Ala-Gln-His-Leu-Arg
- ersonal/eenongen_my_tnstate_edu/_layouts/15/doc.aspx?sourcedoc={a6b083c9-a226-4c31... ☆ Search (Option + Q) Review View Help Picture Editing A В ... During nucleic acid hybridization, the probe is labelled Question 1 options: for DNA stability to increase probe-test DNA binding to identify the location of probe and the test DNA binding for amplification Question 2 6. 9. 10 IV 13 14 Which of the following best describes the trait in the pedigree? Question 2 options: X-linked dominant X-linked recessive autosomal domiant autosomal recessive ON5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13Transposons in bacterial genomes can carry genes,including those conferring ________ resistance
- GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…Note that the table provided shows a ligation using a molar ratio of 1:3 vector to insert. Write out the complete recipe for a 5:1 insert: vector ligation reaction, including the volumes of insert and vector you calculated above, and the volumes required for a 20 uL reaction: Ligase buffer Nuclease-free water T4 DNA ligaseCoding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'