PROBLEM 19 Four C's occur in a row in the segment of mRNA in Problem 18. What polypeptide would be formed from the mRNA if one of the four C's were cut out of the strand?
Q: lculate the mitotix index from the picture below.
A: Mitosis is a cell division which maintains the chromosome number and divides a cell into two…
Q: Consider the relationship between temperature and photosynthesis. As temperatures increase, gases…
A: The pace of photosynthesis is impacted by temperature. Higher the temperature, more prominent the…
Q: you have used the Chi-Square Goodness of Fit test quite extensively. How useful do you find it in…
A: The Chi-Square Goodness of Fit test is commonly used during heredity-related units to find the…
Q: What do EPA and IARC stand for? 2. What are the general categories of Carcinogens recognized by EPA…
A: Introduction :- Cancer is the disease of uncontrolled manipulation or growth of body's own…
Q: Why are the lung fish and considered to have a common ancestor with amphibians
A: Introduction Lungfish are freshwater creatures, these fishes have lungs that are derived from the…
Q: 3. Research and discuss where single-stranded DNA are found.
A: Introduction When a DNA molecule only consists of a single strand contrary to the typical two…
Q: Given the figure below, Which of the following may have caused the formation of bands of the…
A: Thin layer chromatography is a technique which is used to separate the the non volatile compounds.…
Q: A patient with Cushingâ s syndrome due to an adrenal tumor would have high plasma levels of CRH.…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: What is the mode of action for kanamycin? Is it bacteriostatic or bactericidal?
A: Antibiotics are the substance or medicines that either kill the bacteria or cease the growth of…
Q: Explain the Law of Dominance using a monohybrid cross.
A: Introduction In this question we will explain the Law of Dominance using a monohybrid cross.
Q: Snow geese (Chen caerulescens) come in two color types, white “snows” and “blues” with dark bodies.…
A: Hardy weinberg equilibrium defines the non evolving state of a population in the absence of any…
Q: We know fungi are eukaryotic (have membrane-bound nuclei and organelles). Explain three unique ways…
A: *NOTE: Kindly repost for other questions Dear Student as per the guidelines we are supposed to…
Q: What is the rule for the pairing of nitrogen-containing bases in the DNA molecule? And in the RNA?…
A: There are two types of nucleic acids: DNA RNA
Q: Remdesivir is converted in vivo to CMP analog and then phosphorylated to CTP analog.…
A: The correct option is C -: There are more than 1 correct answers in the other choices.
Q: Explain the process that is depicted by the diagram below. (What is the overall purpose of the…
A: Overview of oxidative phosphorylation. The electron transport chain forms a proton gradient across…
Q: How many possible nucleotide sequences could code for a peptide with the sequence "MRRTGERS*"? (Note…
A: The given sequence is 'MRRTGERS*'. The amino acid sequence is…
Q: Apoptosis O is programmed cell death. O is a process that acts to decrease the number of somatic…
A: Apoptosis is the process takes place inside the cell with the series of steps finally resulting in…
Q: During an Action Potential….. _____ Na+ flows out of the cell _____ Na+ activation gates and…
A: Action potential refers to the rapid changes in membrane potential of mostly excitable cells (nerve,…
Q: Role of molecular biology in evolutionary classification
A: Evolution is defined as any change in a biological population's characteristics that is passed down…
Q: Is there any situation in which DNA is made based on a RNA template? What is the enzyme involved?
A: ANSWER;- The cycle in which DNA is synthesized having as a layout an RNA chain is called reverse…
Q: Aposmatic coloration... O provides camouflage against predators O makes an organism look like…
A: Asposmatic coloration * Aposematic or warning coloration is used by some organisms to signal their…
Q: What is triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.
A: This process is known as triple fusion as it involves the fusion of 3 nuclei.
Q: Risk factors for prostate cancer includes all of the following, except Older age (over 65 years old)…
A: Cancer is a fatal disease that has both physical and mental consequences for a person. Cancer can…
Q: What is triple fusion? Where and how does it take place? Name the nuclei involved in triple fusion.
A: The term triple fusion means there is involvement of 3 nuclei. One from sperm nuclei and other…
Q: What are two environmental conditions that might lead to the disappearance of manatees from…
A: The common name of Manatees is sea cows. Trichechus is the scientific name given to manatee. They…
Q: 9 and 10. Name a type of stimulus, describe the kind of energy that defines the stimulus and…
A: * stimulus can be anything that will produces a response in cell of an organism which can be…
Q: Which of these is not an abiotic factor that effects population dynamics? a) dispersal b)…
A: Group of organisms of the same species living together with an common area at the same time is known…
Q: Distinguish the correct order of symptoms that may occur when the brain's dose of toluene goes from…
A: Toluene is a colorless liquid which has sweet odor. It is mainly used as a solvent, in jet fuel, and…
Q: 7... is used for reflex stimulation of centers in the medulla: A. Menthol. solution
A: The mature renal medulla, the inner part of the kidney, consists of the medullary collecting ducts,…
Q: In this example, if a laborador dog has golden fur color, what is its genotype? A. B_E_ B.…
A: Non - Mendelian inheritance pattern is a type of inheritance pattern in which genes or traits are…
Q: 8. In gastroduodenal ulcerations, what coating agent is used? A. Tannin. B. Chamomiles flowers…
A: The gastric secretion includes acid, and digestive enzymes to facilitate the digestion of food.
Q: The allele for freckles is dominant to the allele for no freckles. A freckled man and a woman…
A: A trait is characteristic features that is unique to a particular individual. Mendelian inheritance…
Q: Define Compounding Area of pharmaceutical industry?
A: Compounding area of pharmaceutical industry are that area where pharmacist used to mixes, combine…
Q: Question 28 For the statement below tell which from the list below applies 1. meiosis 2. mitosis 3.…
A: The "cell cycle", also known as "cell division", is a set of processes that occur in a cell leading…
Q: Ruton's mother tells the nurse that she was at school and her boyfriend (not Ruton's father) was…
A: The subjective information like her boyfriend was watching the baby for an hour, telling the baby…
Q: 9. The treatment for heatstroke is to A. Reduce the body temperature as quickly as possible B.…
A: Introduction Heatstroke:- Heatstroke is the most serious heat-related illness, it is a…
Q: Of the encircled portions of a stem cross section in the figure, determine what contains parenchyma…
A: The bulk-forming functioning tissue in just about any organ or biological structure is called…
Q: What can life tables be used for?
A: A life table is a statistics table that shows the mortality and life expectancy for a given group of…
Q: Compare and contrast somatic and visceral reflexes.
A: *NOTE: Kindly repost for other question. Dear Student as per the guidelines we are supposed to…
Q: What would you say to a friend that mentioned that they cannot take X antibiotic because they have…
A: * Antibiotics are kind of medications that stops the growth or destroys microorganisms. *…
Q: What specific evidence do paleoanthropologists cite to support the arguments that Neanderthals had a…
A: Paleoanthropologists consider that Neanderthals had propensity to interbred. The reasons for that…
Q: In your own words, describe the difference between euthanasia and physician-assisted suicide. How…
A: Willful extermination: A specialist is permitted by regulation to take an individual's life by an…
Q: Snow geese (Chen caerulescens) come in two color types, white “snows” and “blues” with dark bodies.…
A: According to Hard-Weinberg Law - If p is the allelic frequency of the dominant allele, q is the…
Q: Mention two strategies evolved to prevent self-pollination in flowers.
A: Self-pollination is the transfer of pollen grains from the anther of a flower to the stigma of the…
Q: Which hominins might be ancestral to us choose one that you find especially interesting (except H.…
A: Miocene Origins of the Hominin Lineage To comprehend the development of any species, we should…
Q: What does the zone of inhibition imply? Does the measurement of the zone of inhibition imply that…
A: The size of the zone of inhibition is usually related to the level of antimicrobial activity present…
Q: How is the splicing of U2-dependent introns different from that of U12-dependent introns? O a.…
A: The non-coding sequences are called introns and hence are needed to be removed from RNA. This is…
Q: Calculate the number of kcal and amount of protein provided by the following formula: 500 mL of 50%…
A: Energy is very important for the functioning of all living organisms. It can be obtained from…
Q: What is pedigree analysis? Suggest how such an analysis, can be useful.
A: Pedigree analysis is a kind of genetic analysis in which a trait is traced through several…
Q: Cell growth kinetics A mouse-mouse hybridoma cell line is used to produce monoclonal antibody.…
A: A batch culture begins with sterilization, and the sterile culture is then inoculated with…
Step by step
Solved in 2 steps
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene15-2. Explain whether the following statements are true or false.Justify the false ones.A. Ribosomes are the cytoplasmic structures that duringProtein synthesis is linked by an mRNA moleculeforming polyribosomes.B. The Leu-His-Arg-Leu-Asp-Ala-Gln-Ser- Amino Acid SequenceLys-Leu-Ser-Ser is a signal sequence that directs proteinsinto the endoplasmic reticulum.C. All transport vesicles in the cell must have av-SNARE protein in its membrane.D. The transport vesicles carry protein and lipid to thecell surface.E. If the delivery or distribution of lysosomal proteinsprospects from the trans-Glogii network to endosomes areblock, lysosomal proteins would be secreted by pathwaysof constitutive secretion like those in Figure 15-28.F. Lysosomes digest only substances that have been takenby cells by endocytosis. 15.3 Many of the proteins produced in the reticulumendoplasmic changes such as the addition ofcarbohydrates (oligosaccharides). What is the function of thesesugars in such proteins? 15.4…Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand is in the cytoplasm of a cell and translation is in progress. Draw and label all the necessary main players needed for translation to occur. Included in your drawing should also bee 3 tRNAs , these 3 tRNAs should represent two different forms of tRNA. MRNA 5' ------------AUG------------AGG----------GAG
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anMRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acid
- A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third baseInstructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA anticodons for each of the mRNA codons (c) The sequence of amino acids in the resulting polypeptide. (d) Provide the sequence of another possible DNA strand that will lead to synthesis ofthe same polypeptide.
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above sequence? Please use the one-letter code for your answers. (You will need to consult the Table of the Genetic Code for this question) 1st letter UUU Phe UCU UCC Leu UCA UCG U UUC UUA UUG CUU C CUC CUA CUG AUU A AUC AUA AUG U GUU G GUC GUA GUG CCU Leu CCC CCA CCG ACU lle ACC ACA Met ACG GCU Val GCC GCA GCG с Second Letter Ser Pro Thr Ala UAU UAC A | AAU AAC AAA AAG GAU GAC GAA GAG Tyr CAU CAC CAA Gin CAG 1 UAA Stop UGA Stop A UAG Stop UGG Trp G His Lys UGU UGC Asp Glu G 3rd Asn AGU Ser U letter AGC AGA AGG Cys U CGU CGC Arg CGA CGG GGU GGC GGA GGG DCAG DUAG DUCAG Arg Gly UCAG