Please write the lines that the code will print out. Assume the following addresses: a in main has the address 1000-b in main has the address 1004 c in main has the address 1008 - d in main has the address 1012 - b in fooA has the address 2000 a in fooA has the address 2008 int fooA (int* b, int&c, inta) { (*b) + + ; c+ = 2; a + = 4; cout «

Please write the lines that the code will print out. Assume the following addresses: a in main has the address 1000-b in main has the address 1004 c in main has the address 1008 - d in main has the address 1012 - b in fooA has the address 2000 a in fooA has the address 2008 int fooA (int* b, int&c, inta) { (*b) + + ; c+ = 2; a + = 4; cout «

C++ Programming: From Problem Analysis to Program Design

8th Edition

ISBN:9781337102087

Author:D. S. Malik

Publisher:D. S. Malik

Chapter7: User-defined Simple Data Types, Namespaces, And The String Type

Section: Chapter Questions

Problem 1TF

See similar textbooks

Similar questions

Using C++ Programming language: Given the following definitions: int num1=1, num2=2; int *ptr1=NULL, *ptr2=NULL; Write the following statements: Assign ptr1 to the address of num1. Assign ptr2 to the address of num2. Using pointer notation, write a statement that compares the values that the pointers "point" to to see which is larger. (There is more than one way to do this. You choose.)
C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…
Code write () 9.
Month Day Calculator in C Using basic concepts of Pointers and Structures (Pointers and Multi-dimensional arrays), create a C program that calculates the month's day from a given year and year's day. Use pointers for the month and month's day variables. Don't forget to add proper errors handling in your program. - Follow the instructions below for handling error. - Invalid Input- Invalid year- Invalid year day Modify the provided monthAndDay.c class file to receive the parameters in the way and also print the proper formatted output. Example: # ./month_day <year> <yearday> # Example for Feb 2nd, 2019:\$ ./month-day 2019 33Feb 02, 2019 class- monthAndDay.c - #include <stdio.h> /* monthAndDay function's prototype*/void monthAndDay(int year, int yearday, int *pmonth, int *pday); int main() {return 0;}
Task related to pointers : Write a c++ program that asks the user to enter integers as inputs to be stored in the variables 'a' and 'b' respectively. There are also two integer pointers named ptrA and ptrB. Assign the values of 'a' and 'b' to ptrA and ptrB respectively, and display them. ( Drop code in words , explain the code and drop the screenshot of output as well )
Segmentation: Select all of the following statements that are true. In segmentation, a logical address always has a length of 32 bit. In order to translate logical into physical addresses, the memory management unit uses the segment part of the logical address to determine the start address in the segment table and adds the offset to this to get the physical address. In segmentation, the logical address consists of a segment part and an offset. The segment length is limited by the maximum possible segment number. When applying segmentation, processes are only allowed to access the memory within their segments. Segments can be assigned access rights and privilege levels.
Look at the following C++ code and comment each line about how it works with pointer. int i = 33; double d = 12.88; int * iPtr = &i; double * dPtr = &d; // iPtr = &d; // dPtr = &i; // iPtr = i; // int j = 99; iPtr = &j; //
7. Translate the following function into pseudo-assembly: Void swap_nums(int a, int b){ if (a b) return a; 3 int temp = 0; temp = a; a = b; b temp;
2- In C++ language, every line of code must end with a semicolon. (True or False). 3- It is not possible to change the value of the pointer. (True or False). 4- If the following lines of code have errors, correct them; otherwise, write "no errors." for (int i=2; i<5; i++) { int s=i*2; } cout << S; 5- A function cannot be called from inside another function. (True or False). 6- How to make a function return multiple values? 7- Every class member is by default. (public, private, not public nor private) 8- Create an instance of the following class and call its methods. class Exam{ int grade; public: void seta (int b) (grade=b; } int geta () {return grade; } 9- When the word const is put before the variable definition, what does that mean? 10- How to concatenate two strings in C++ language? C++
C++ language Write a program using Switch statement to perform the following functionalities.1. Press a to call functionOne.2. Press b to call functionTwo.3. Press c to call functionThree.4. Exit as any other key pressed.(default)functionOne will return product of all integers entered by user in array of size 8.functionTwo will perform greatest value in array entered by user.funtionThree will calculate lowest value in an array entered by user.
Minutes(using Pointers) by Catherine Arellano Write a program that will accept an integer value from 0000 to 2359. It will then extract the first 2 values of the integer to be the hours, and the last 2 to be the minutes. Implement the following functions: void extracts(int* time, int* hour, int* min); /* extract the hours and minutes from the time and stores the result to the address of hour and min respectively.*/ void display (int* hour, int* min); /*display the hours and minutes*/ Note: You are not allowed to edit main.c and Time.h. Input A time in format HHMM 1430 Output Hours and minutes Hour: 14 Minutes: 30 main.c Time.h 1 #include 2 #include "Time.h" 3 int main(void) { M456909 7 8 } int time, hour, min; scanf("%d",&time); extracts (time, &hour, &min); display (&hour, &min); return 0;
#include <stdio.h>void cubeByReference( int *nPtr ); // function prototypeint main( void ){ int number = 5; // initialize number printf("The original value of number is %d", number ); // pass address of number to cubeByReference cubeByReference( &number ); printf("\nThe new value of number is %d\n", number );} // end main void cubeByReference( int *nPtr ){ *nPtr = *nPtr* *nPtr* *nPtr;} passing argument by reference - We modify the code above 1- define a second argument (example "int number2 = 9") and a pointer to it 2- define a second function (addByReference) that adds number2 to number - passing both arguments by reference 3- print-out the result (that is in number) Upload the output and .c code