state the five functions of globular proteins, and give an example of a protein for each function
Q: 1. Hydrolysis of 1 M glucose 6-phosphate catalyzed by glucose 6-phosphatase is 99% complete at…
A: Standards free energy change calculated at biochemical standards is called biochemical standard free…
Q: The carbon-carbon bond distance for single-bonded carbons, such as those in a saturated fatty acyl…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: argarines made from plants oils are healthier ,since they are hydrogenated. A) TRUE B)FALSE
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons. The…
Q: differentiate the intermdeiates in term of theri reaction with lugol's solution and benedict…
A: Starch is the main source of carbohydrates, it is commonly found in nature. The foods like,…
Q: In a case where the energy source to be used it 1 malate unit, exactly how many ATP can be yielded?…
A: Cellular respiration is a collection of three metabolic pathways that generate ATP from oxidation of…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ Determine the…
A: Genes are functional segments of DNA that code for particular proteins. Each gene has its unique…
Q: In an enzyme-catalyzed reaction where enzyme concentration is held constant and substrate…
A: Enzymes are biological catalysts. They increase the rate of the reaction they catalyze. There are…
Q: Calculate θ for a certain protein-ligand pair when the ligand concentration = 1 M and the Kd = 1 X…
A: The core of biology is molecular connections. Two molecules, such as a ligand and a receptor, must…
Q: Erythropoietin (EPO) is a glycoprotein hormone that stimulates the production of erythrocytes in red…
A: Glycoproteins are proteins which contain oligosaccharide chains (glycans) attached to amino acid…
Q: Question 22 Each GroEL subunit has an ATP-binding pocket that catalyzes hydrolysis of its bound ATP…
A: GroEL-ES is a molecular chaperone complex assit in folding of cellular proteins. GroEL is composed…
Q: The unicellular fungus Saccharomyces cerevisiae is used in the food industry to ferment sugars. The…
A: In animals, Pyruvic acid has two possible fates in the cell: be oxidised into acetyl CoA and enter…
Q: I'd like you to explain to me the structure of one of your macromolecules. You should be describing…
A: Bio molecules or biological molecules that are formed in the body of living organisms. These are…
Q: Calculate the expected activity for each unknown hallucinogen using the QSAR relationship that you…
A: QSAR (Quantitative Structure-Activity Relationship), is a technique used to predict the activity of…
Q: 3. A. Briefly discuss the four levels of structure in proteins. Knowing that the 3-dimensional shape…
A: Protein is a polypeptide made up of amino acids. The sequence of amino acids determines the…
Q: The rate of transformation of S, have been determined in the presence of two compounds M and N.…
A: Enzyme Inhibitors are the substances that can bind to enzyme and inhibit the enzyme activity . On…
Q: What is the difference between high and very high energy bond molecules? Give 2 examples of each.…
A: Higher the bond energy, more unstable that bond is. Hence, upon breaking of that bond, a large…
Q: Describe 3 Application of AI in Medicine
A: AI stands for artificial intelligence. Nowadays AI is used widely in every sector including…
Q: In the liver, higher levels of NADH promote gluconeogenesis. I'm curious as to your thoughts on this…
A: Gluconeogenesis is defined as the de novo synthesis of glucose from a non-hexose or non-carbohydrate…
Q: Students carry out a laboratory experiment with avidin (a protein in eg white) having a very high…
A: Enzymes are proteins that catalyse biochemical reactions. Sometimes enzymes require a non-protein…
Q: Clinical Chemistry The concentration of Nations in red blood cells (11 mM) and in the surrounding…
A: The unequal separation of ions across a membrane will lead to the generation of a potential…
Q: Some scientists debate whether it is correct to consider pyruvate as “the end of glycolysis”.…
A: Introduction All living organisms require energy. They get energy from cellular respiration.…
Q: Question 11 Matching: (one answer can be matched to more than one questions). An answer can be used…
A: Liposomes and micelles are composed of phospholipids. Lets first know the characteristics of…
Q: Question 3 Matching. Some answer(s) could be matched more than once to a question. ✓ Patients'…
A: After a meal, there is a surplus supply of glucose in the blood. this causes the pancreas to secrete…
Q: The acronym DFR stands for what?
A: Biomolecules often have long complex names. The use of acronyms helps us simply the name of complex…
Q: How many mL of 10 x stock solution would you need to make 118 mL of 1x PBS? Report your answer to 1…
A: The equation of dilution: C1 x V1 = C2 x V2 Where, C1 is the concentration of the stock solution. C2…
Q: In determining the activity of an enzyme of choice, which do you prefer, monitoring the product…
A: Enzymes are biological catalysts that enhance biochemical reactions in living organisms. The…
Q: This assay is the most common method of detection in enzyme assays: A. рН B. spectrophotometric…
A: Enzymes are the biological catalysts that can convert substrate molecules to products. Enzyme assays…
Q: 9. Compartmentation in ß Oxidation Free palmitate is activated to its coenzyme A derivative…
A: Beta oxidation is the biochemical pathway by which fatty acids are broken down two carbon at a time…
Q: 1) Which of the following contains all of the information required to target a precursor protein…
A: e. None of the above The correct answer is none of the above. Targeting of a precursor protein from…
Q: What chemicals do you think are most harmful to your own health? How are you exposed? How could you…
A: Benzene and other aromatic hydrocarbons, along with heavy metal compounds are one of the the most if…
Q: 3. Please draw the core structure of Lignan, and numbering the C-atoms.
A: In 1948, Haworth first introduced the term "Lignan", which are also subgroup of non-flavonoid…
Q: Consider the reaction below. Where would the labelled carbon (represented by the asterisk * in the…
A: As you can see the reactant side is undergoing the reaction where there is removal of CO2 and NADP+…
Q: True of false 6. In glycogen synthesis, the active form of glucose is UDPG. () 7. If people lack…
A: Glycogenesis : It is the process of synthesis of glycogen from glucose. Glycogen is a polymer of…
Q: Sugar Molisch's Solution Test Glucose Sucrose Lactose Hydrolysis: Samples Sucrose hydrolysate Starch…
A: Glucose , sucrose, lactose, starch all are carbohydrates. Glucose is the simplest carbohydrate of…
Q: TPI deficiency is a rare human condition. Patients who lack TPI cannot convert the triose…
A: Glycolysis is the metabolic pathway that converts 1 molecule of glucose to 2 molecules of pyruvate…
Q: RUE OR FALSE 1. Abzymes reduce rotational entropy. 2. Hammerhead ribozymes have the ability to bind…
A: Enzymes are catalysts acting inside the living system to reduce the reaction time and speed up the…
Q: Using this information, offer some observation of the relevance of phosphorylation to the function…
A: ZIPs are a group of Protein channels that aid in the transfer of Zinc ions (Zn2+) from extracellular…
Q: Please provide an example of a molecule that is soluble in water. Please explain why it is soluble…
A: The ability of a solvent to have stronger interactions with a particular solute than the interaction…
Q: Focusing on the mechanism linking complex I and ATP synthase depicted in figure 3 in the article,…
A: Peter Mitchell in t the chemiosmotic theory proposed that there exists a membrane localized,…
Q: Draw an approximate titration curve for lysine, given that its pKa(COOH) = 2.18, its pKa(NH3*) =…
A: Amino acid has a typical structure. It has a central Carbon atom called (Cα). To it 4 groups are…
Q: Given the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the…
A: The proteins are constituted of twenty naturally occurring amino acids. Each amino acid is encoded…
Q: Without "unraveling" the following carbohydrates, classify each as a ketose or aldose HO но- HỒ CH…
A: The classification of a carbohydrate as a ketose or aldose depends on the location of the carbonyl…
Q: Which of the following has the lowest probability of cardiac event-free survival? high CRP and…
A: Introduction LDL (low-density lipoprotein) is also known as bad cholesterol. It can cause blockage…
Q: Consider the following peptide: alanyl-glutamyl-lysyl-cysteyl-asparagine. 1- Write the…
A: The given peptide is comprised of 5 amino acids. In order to write the name of a peptide , we add…
Q: The rate constants of an enzyme-catalyzed reaction, obeying the Michaelis-Menten kinetics, have been…
A: The enzyme interacts with the substrate by attaching to its active site to produce the…
Q: What is the abbreviated name of the human gene that contains the CAGATTGTGAAGAGGTCTCTTGA? following…
A: Nowadays there are various tools that are used in bioinformatics to find out the gene from the gene…
Q: c) Explain why the proton Mitchel's proton gradient mechanism is implausible. What is the most…
A: The chemiosmotic theory (some would argue that it is still a hypothesis and not a theory) is well…
Q: For the reaction A + 2 B 3 C + D, what is the magnitude of the rate of change for [D] when [C] is…
A:
Q: Name : Surname: 2. The amino acid side chain residues in an a helix point center of the helix. A)…
A: The proteins consist of 20 naturally occurring amino acids. The proteins must fold into the proper…
Q: Uronic acids are another class compound for carbohydrates. a) Describe the structural difference…
A: Chemically carbohydrates are polyhydroxy acetone or ketones. Uronic acids are also carbohydrates…
please state the five functions of globular proteins, and give an example of a protein for each function?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- • Which division of the autonomic nervous system would likely be activated if a student learned that an exam they had forgotten about would start in 5 minutes? Explain. • Which one of the five categories of sensory receptors is primarily dedicated to external stimuli? • Explain what is happening here in muscle contraction. Be sure to tell me what role Ca+, ATP, myosin, and actin play. Thin filaments feee Binding of a new mol- ecule of ATP releases the myosin head from actin, and a new cycle begins. Thick filament Thin filament moves toward center of sarcomere. Myosin head (low- energy configuration) Releasing ADP and ℗. myosin returns to its low-energy configuration, sliding the thin filament Starting here, the myosin head is bound to ATP and is in its low-energy configuration. -Myosin head (low- energy configuration) Cross-bridge Thin filament Thick filament Actin The myosin head hydrolyzes ATP to ADP and inorganic phosphate () and is in its high-energy configuration. Myosin binding…3. [Essay] Do you know "IceBucket challenge"? The purpose of this public welfare activity is to help the patients with amyotrophic lateral sclerosis. The main symptom of amyotrophic lateral sclerosis is that the muscles of the patients gradually shrink until they die. However, not all muscles of the patients with amyotrophic lateral sclerosis are atrophic. Combined with the knowledge of muscle tissue we have learned, please talk about the types of muscle tissue, and what are the differences in the structure and function of these muscle tissues? What type of muscle atrophy in patients with amyotrophic lateral sclerosis?The muscular system is the one that receives the stimuli from the environment and executes a response. Select one: O True O False ort Jump to... I COLLADO ESPINAL (Log out) - (SP 2022- Prof. María Ruíz):
- Which of the following statements is false? Slow fibers have a small network of capillar ies. Slow fibers contain the pigment myoglobin. Slow fibers contain a large number of mitochondria. Slow fibers contract for extended periods.State the function of the following: Tropomyosin Troponin calmodulin electrocytes sonic muscles smooth muscle gap junctions cardiac muscle desmosomes smooth muscle agonist receptor Cardiac muscle dihydropyridine receptor Skeletal muscle dihydropyridine receptorDiscuss the following statement: “The basal lam-ina of muscle fibers serves as a molecular bulletin board,in which adjoining cells can post messages that direct thedifferentiation and function of the underlying cells.”
- hello sir Explain in detail about different local and systematic responses between biomaterial and tissues interactions???While the sarcoplasmic reticulum of muscle was first described by nineteenth-century microscopists, its true significance was not ap-preciated until its intricate structure was revealed much later by the electron microscope. What could you tell a nineteenth-century microscopist to enlighten him or her about the structure of the sarcoplasmic reticulum and its role in the coupling of excitation and contraction?classifications of carbs fibre give a summary of this classification:
- Slow-twitch (type I/red) fibers have a distinctive feature: fatigue easily relatively low quantities of glycogen relatively low quantities of myoglobin show a fast response relatively low quantities of mitochondriaSkeletal muscle cell(key terms: striated, contracting proteins, contractions, nucleus location) One important structure/feature of a muscle cell isSelect ALL that could cause muscle cramping (a sustained muscle contraction) in skeletal muscle: OHyperexcitability of somatic motor neurons (secreting too much Ach) Botulism poisoning, which prevents Ach secretion from somatic motor neurons O Myasthenia Gravis, in which antibodies block Ach receptors at the motor end plate, preventing Ach from binding O Hypocalcemia, in which the calcium pumps of the sarcoplasmic reticulum are unable to keep Ca2+ inside the SR (allowing Ca2+ to leak into the cytoplasm)