Please identify the following on the Michaelis- Menten plot shown A, B, C, and the X and Y axes. Please briefly explain the significance of each.
Q: Question 3 The amino acid histidine is very important biologically and can also be used as a buffer.…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group linked to…
Q: Calculate the ATP yield for the full catabolism of a phospholipid containing ethanolamine, C18:3 Δ9,…
A: The catabolism of a phospholipid containing ethanolamine and oleic acid begins with the breakdown of…
Q: Question 1 The dipeptide below is formed by linking the amino acid isoleucine via amide bond to the…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side chain all linked…
Q: A synthetic substrate, the para-nitrophenylacetate (PNPA), is used to monitor enzyme activity of…
A: Enzymes are protein that catalyse biochemical reaction. They speed up biochemical reaction but do…
Q: 1. Similarities between glucose, galactose, and fructose? 2. Differences between glucose,…
A: Monosaccharides are the simplest form of carbohydrates, also known as simple sugars. They are…
Q: Draw the Beta-oxidation pathway of saturated and unsaturated fatty acids, fatty acid synthesis of…
A: Chemically, fatty acids are long hydrocarbon chain carboxylic acids. They are classified based on…
Q: Using the cultured cells used in this experiment and described in the introduction, how would you…
A: When increasing amounts of the labelled ligand are added to the cells, the amount of binding will…
Q: .Hanes-Woolf 2.Michaelis Menten 3.Lineweaver-Burk limitations: A. This plot appears to allow for…
A: For enzymes that follow Michaelis Menten-type kinetics, the determination of accurate values of Km…
Q: cysteine amino acids together in the formation of a disulfide bond and the biological compound…
A: TLC is a versatile and widely used technique in chemistry and biochemistry for separating and…
Q: A higher concentration of NADH in the liver is associated with an increase in gluconeogenesis. Your…
A: NADH (nicotinamide adenine dinucleotide) is a coenzyme that plays a critical role in many cellular…
Q: A 24-residue peptide called Pandinin 2, isolated from scorpion venom, was found to have both…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: The table below gives the initial velocities of a decarboxylase, determined at various [S], in the…
A: Km is the Michael's menton constant which can be determined as the substrate concentration at half…
Q: Lipids affect your health? why or why not
A: Lipids include fats, oils, waxes, and certain types of steroids. They are an essential component of…
Q: list the primary energy system out of these 3 (only pick 1) (TP-PC System, Glycolysis & Citric Acid…
A: Food is the composition of carbohydrates, fats and proteins. On digestion these macromolecules are…
Q: what is the purpose of staggering the start and stop of the reactions? With reference to your…
A: Chemical reaction optimization is the process of using various techniques to improve the efficiency,…
Q: Part 2 Monosaccharides and disaccharides are two of the sub-classes of Carbohydrates. Structure B…
A: The most prevalent category of biological substances is carbohydrates. They consist of starches and…
Q: 9. Circle and name three polar functional H₂C H. CH OH CH3
A: A polar functional group is a group of atoms in a molecule that contains polar covalent bonds,…
Q: When the disaccharide is hydrolyzed, the monosaccharide units that are produced are
A: Carbohydrates are one of the three macronutrients that provide energy to the body, the other two…
Q: 10 glucose molecules are used in anaerobic respiration. How many ATP will be yielded under these…
A: Cellular respiration occurring when oxygen is absent is known as anaerobic respiration. It is a…
Q: raw the following Lipids in A) Condensed (detailed) Structure, B) its Block Diagram. C)…
A: Biological waxes are esters of long-chain fatty acids and long hydrocarbon-chain alcohols. They are…
Q: Explain the reason why sugars that are polysaccharides are almost always insoluble in ethanol. B.…
A: Sugars are sweet tasting carbohydrates . Polysaccharides are carbohydrates made up of numerous…
Q: - Calculate ammonium sulphate, NADH, a-ketoglutarate and proteins concentrations in the reaction…
A: In order to calculate the concentration of species in the reaction medium at time =0, we need to…
Q: Can you explain the process of beta-oxidation for saturated and unsaturated fatty acids, and the…
A: Fatty acids are building block of fats in our body and it constitute a carboxylic acid with an…
Q: Deduce the amino acid sequence of a polypeptide from the following: 1. Acid hydrolysis gives Ala2,…
A: Deducing the amino acid sequence of a polypeptide from the analysis of peptide fragments generated…
Q: 1. A 200-lb man would be expected to have how many pounds of blood? A. 5 C. 16 B. 8 D. 20
A: “Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Biochemical significance of transamination reactions
A: The reactions that involve the transfer of amino group from an amino acid to a keto acid to form a…
Q: Enalapril is inactive until acted upon by an esterase. Draw the structure of the resulting bioactive…
A: Enalaprilat is an angiotensin-converting enzyme (ACE) inhibitor that is used to treat hypertension…
Q: A tetrameric protein dissociates into dimers when the detergent sodium dodecyl sulfate (SDS) is…
A: Proteins are polymers of amino acids linked by peptide bonds. Proteins can be single chain or more…
Q: Create a concept map connecting cancer and pyruvate kinase m2
A: Pyruvate kinase plays a very important role in cell metabolism. It catalyses the rate limiting step…
Q: Glycation is a process which contributes to a decreased sex drive due to increased absorption of…
A: Introduction:- The question is about the process and again what option is correct for it so frankly…
Q: Fill in the blank 1.) triaycerols form_____ rather than lipid bolsters 2.) the most abundant…
A: Triacylglycerols are fatty acid esters of glycerols, with 3 fatty acids (long hydrocarbon chain…
Q: At what points in the entire process of aerobic respiration is ATP generated?
A: ATP (adenosine triphosphate) is a molecule that serves as the primary energy currency of cells. It…
Q: Name the most important proteins in plasma and their functions.
A: Plasma contains a complex mixture of proteins, most of which are synthesized in the Liver.
Q: 3.) As mentioned in the March1 outline a critical step in the glycolysis metabolic pathway…
A: Triose phosphate isomerase catalyzes the interconversion between Dihydroxyacetone phosphate (DHAP)…
Q: What makes RNA a ribozyme? Why are DNA enzymes absent?
A: Enzymes are biomolecules which can catalyze the biochemical reactions. These can be proteins, RNA or…
Q: You undertake a research project with your favorite biology professor to analyze the behavior of an…
A: Enzymes are biocatalyst which are mostly proteinaceous in nature. Enzymes catalyze by increasing the…
Q: The parents of a 4-year-old boy noticed that his urine darkens almost to black, after being left in…
A: The black urine disorder is a rare inherited disorder. It is also called phenylketonuria. Conversion…
Q: What enzyme will not be used if the oxidative portion of the pentose phosphate pathway is operating…
A: The pentose phosphate pathway also called the hexose monophosphate shunt is an alternative pathway…
Q: first pass metabolism
A: The mechanism of first-pass metabolism involves the biotransformation of a drug or substance by…
Q: Prepare one dose of 0.6 mg kanamycin in 2mL diluted from a stock solution of 20 mg/ml. How much…
A: The formula for dilution: C1 x V1 = C2 x V2 where, C1 = concentration of the stock solution V1 =…
Q: What are the reagents found in a restriction enzyme digestion buffer? What are the roles of these…
A: Restriction enzymes are enzymes that recognise and cleave DNA at or near specific DNA sequences.…
Q: 4. At pH 9.5, what is the net charge of the peptide LTDQRHGE?
A: Peptide is composed of polymer of amino acids (length of 13 to 17 amino acids) which is linked by…
Q: How is the Citric Acid Cycle regulated, and how does this compare to glycolysis regulation?
A: The Citric Acid Cycle (also known as the Krebs cycle) is a series of enzyme-catalyzed reactions that…
Q: Question: A man inspires 1000 ml from a spirometer. The intrapleural pressure was 24 cm H2O before…
A: The compliance of a system is defined as the change in volume that occurs per unit change in the…
Q: 1.c)B vitamins are involved in energy production. must be injected to be effective. are fat-soluble.…
A: B vitamins are water soluble vitamins which are of classified into 8 types. they are Thymine ,…
Q: Create an illustrated step-by-step schematic diagram of the following Analysis of Lipids: Huble's…
A: Huble's test is done to identify the degree of unsaturation in lipid. Huble's reagent is used in…
Q: When protein is converted in the body to amino acids, what is the role of water? Only beef proteins…
A: Proteins are essential nutrients that the body needs to function properly. They are important for…
Q: In the potato catalysts experiment on the left one at frozen potato and in middle room temperature…
A: Enzyme activity can be affected by various factors such as temperature, pH, substrate concentration,…
Q: 6. Retroviruses have an RNA genome instead of a DNA genome, and the RNA must be copied into the…
A: Retroviruses are a type of virus that has a unique way of replicating their genetic material. Unlike…
Q: Regulation of the Citric Acid Cycle
A: TCA (Tricarboxylic acid) cycle is the major energy yielding metabolic pathway utilized by lifeforms.…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- 1. How many TSS sites were identified using this technique? 2. Look at the labels next to each of the annotated TSSs. What are the labels for the TSS sites? 3. What is the coordinate for TSS_tra_16584216?Briefly discuss (using three sentences) how the concepts and/or techniques in molecular biology are applied in COVID-19 pandemic, (Note: please answer with proper grammar for it to be easily understood since if the presentation of arguments are chaotic the point of the answer would be hard to understand.)Explain the structural activity between trans-ferulic acid and the NS2B-NS3 protease in the DENV-2 strain? Please refer to the specific conserved domains affected in the NS2B-NS3 Protease by trans ferric acid and how trans ferric acid can prevent viral replication by inhibiting the activity of the NS2B-NS3 protease in DENV-2.
- As stated in the text, bacteriophages have been discovered with the followingbase substitutions in their DNA:(a) dUMP completely substituting for dTMP(b) 5-hydroxymethyl-dUMP completely substituting for dTMP(c) 5-methyl-dCMP completely substituting for dCMPFor any one of these cases, formulate a set of virus-coded enzyme activitiesthat could lead to the observed substitution. Write a balanced equation foreach reaction you propose.Download BLOSUM30 and BLOSUMB0 substitu- tion matrices and place them side by side on your computer screen. What are the differences between the two matrices? Why do you see these differences?A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…
- Considering counting rules, calculate the initial titre of the sample viral stock if the following plaques were counted in a plaque assay. Show clear sample calculations. Table 1: Plaque assay counts for lambda phage stock titre enumeration of average concentration (PFU/mL) Total dilution of viral stock 1/13500000 1/135000000 1/135000000 plated Volume diluted viral stock 0.1 0.1 0.1 plated (mL) PFU replicate 1 TNTC 275 25 Calculated concentration (PFU/mL) replicate 1 PFU replicate 2 TNTC 239 23 Calculated concentration (PFU/mL) replicate 2 Average concentration (PFU/mL)Identify the open reading frame for the following sequence: CACAGCCTACTAATGGTGTTGGCTAT Note: When I first attempted this question I identified the open reading frame as starting from ATG. However I was told that my reading frame was wrong and that the frame should include an asparagine group but how it that possible?Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer
- The pathway for arginine biosynthesis in Neurospora crassa involves several enzymes that produce a series of intermediates as shown. O O O O ornithine citrulline ARG-E arginosuccinate arginine N-acetylornithine arginine You did a cross between ARG-E ARG-H* and ARG-E* ARG-H¯¯ Neurospora strains and identified an Arg- strain from an NPD tetrad. (Assume that Neurospora forms tetrads in the same way yeast do.) Which compound would rescue growth of this Arg- spore? N-aceltylornithine ARG-F ornithine citrulline ARG-G ARG-H → argininosuccinateDescribe and explain the difference in results if the serial dilution step of the T4 bacteriophage suspension inour experiment was skipped (i.e., all of Step #3 of the procedures was skipped)? _________________________Current EventsThe Johnson and Johnson COVID-19 vaccine consists of inactivated adenovirus that has been altered to containgenetic information encoding SARS-CoV-2 surface spike proteins. The virus targets and delivers this geneticinformation to the cells of our respiratory tract, which produce benign SARS-CoV-2 surface spike proteins butare effective for training our immune system to defend us against SARS-CoV-2.Based on this information and your knowledge of viruses in general, could T4 bacteriophage be used in place ofFor the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG