Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in length. The DNA sequence of the lilP gene is shown below. 5'-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACTAGaaatattatttaa-3' 3'-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGATCtttataataaatt-5'
Q: Which of the following is/are possible disadvantage(s) of intravenous (IV) delivery?…
A: Introduction :- Hemolysis is the destruction of red blood cells, which can lead to the release of…
Q: During hibernation, norepinephrine is produced by the brain and released into the bloodstream. Based…
A: Hibernation: Several animal species enter a condition of hibernation, which includes reduced…
Q: Methodology of the topic "Habitat Niche Partitioning of Anurans in Waterfalls".
A: Introduction: Different species that coexist in the same ecosystem can utilise the resources…
Q: 8. A. Use Excel (or another graphing program) to draw the growth curve, In (X/X.) vs time, for…
A:
Q: A cell is grown on minimal media containing only 3-phosphoglyceric acid as a source of carbon and…
A: Introduction: Metabolic pathways are a series of chemical reactions that occur within a cell to…
Q: Use the following information to answer the next question Giraffes and other hoofed animals,…
A: Note: According to bartleby guidelines only first question is to be answered. Please upload others…
Q: Contrast pulmonary and systemic circulation.
A: Introduction : The circulation in animals is divided into two circuits. Hence, the blood is…
Q: Make a thesis introduction of the topic " Cat Taxidermy". Cite your citation with url.
A: A thesis is a statement or central argument that a writer puts forward and supports through evidence…
Q: In two sentences answer the following question. If all sheep cells have keratin genes for making…
A: Introduction :- Keratin is a family of fibrous proteins that are the main structural component of…
Q: Which environment is most conducive to a child developing a rich vocabulary quickly? formal…
A: Introduction Development is the process of growth and change that occurs over time, resulting in an…
Q: nucleus, nucleolus
A: Cellular organelles are specialized structures within a cell that perform specific functions…
Q: Describe the sharks' skin coloration, scales, skeleton, appendages, body form, and position of its…
A: Introduction :- Sharks are a diverse group of fish that have been around for over 400 million years,…
Q: 15. Which of the following rows provides the probable percentage of this population with each…
A: The given questions are related to the population genetics and population ecology. The study of…
Q: Question 3 Fill in the Blanks A transcription start B CDEFGH ATG translation initiation codon…
A: Mature mRNA is formed after primary mRNA is formed by the process of transcription. Various changes…
Q: How does fermentation differ from respiration in the generation of ATP and the final electron…
A: In glucose fermentation process, there is a net gain of 2 ATP molecules in the glycolysis process.…
Q: Which environment is most conducive to a child developing a rich vocabulary quickly? formal…
A: Learning refers to the process of acquiring new knowledge, skills, behaviors, attitudes, or values…
Q: It has been said that humans are a keystone species. Do you agree or disagree with this statement.…
A: Introduction: A species is a group of organisms that share common physical and genetic traits, can…
Q: Discuss the safety equipments considerations in cryogenic plant -Emergency Lighting - Emergency…
A: A cryogenic plant is a specialized industrial facility designed to produce, store, and transport…
Q: Hereditary deafness is an autosomal recessive disorder that occurs in 30% of Dalmatian dogs. 4. What…
A: Introduction : According to the Hardy-Weinberg principle, the frequency of the allele in a…
Q: Question 21 @ 2 What of the following is a cytokine that is released by one cell to a neighboring…
A: Introduction :- Cytokines are a group of signaling molecules that are produced by cells of the…
Q: In your opinion, is antibiotic use at farm sites promote the development and spread of antibiotic…
A: ARGs stands for antibiotic resistance genes, which are genes that encode proteins or enzymes that…
Q: Explain using words and diagrams the structure of carbohydrates 2. Demonstrate understanding of…
A: Carbohydrates are organic compounds that are composed of carbon, hydrogen, and oxygen in a ratio of…
Q: A cell is grown on minimal media containing only glyceraldehyde 3-phosphate as a source of carbon…
A: Introduction :- Glyceraldehyde 3-phosphate (G3P) is a three-carbon molecule that is an important…
Q: Compare and contrast how the lagging strand is replicated in E. coli and in eukaryotes. Highlight…
A: While there are many similarities between the replication of the lagging strand in E.coli and…
Q: In the past 500 million years there have been ________ mass extinction events. A. two B.…
A: Introduction Extinction refers to the complete disappearance of a species or group of organisms…
Q: This UCP1 protein allows the protons (H+) of the mitochondrial intermembrane space to enter the…
A: UCP1 is a unique protein that plays a critical role in thermogenesis and energy balance, and it may…
Q: Panadol is a drug named under . O Chemical O Generic O Trade O Formula O Source name
A: Drugs are the medicines and are named differently either according to the chemicals present in them…
Q: 1. Write the summary chemical equation for photosynthesis.
A: INTRODUCTION- Photosynthesis is the process by which plants, algae, and some bacteria convert light…
Q: Analyze the fly wing (left) and the bird wing (right). Are these structures homologous or analogous?…
A: Homologous structures are body parts in different species that have the same fundamental structure…
Q: When your white blood cells encounter pathogens, they use harsh chemical reactions to destroy…
A: Vitamin C is also known as Ascorbic acid ( a water soluble vitamin), which plays vital role in…
Q: Why would you look for ARGs in a farming context And why specifically in the waste manure produced…
A: In the context of microbiology and genetics, ARG stands for antibiotic resistance gene. These are…
Q: What are the specific benefits to the elderly population and the community by meeting the healthcare…
A: Introduction :- Health is a state of complete physical, mental, and social well-being and not merely…
Q: A Manton-Gaulin homogenizer is used for cell lysis. Which of the following are true?…
A: Cell disruption refers to the process of breaking down or lysing cells in order to release their…
Q: what did percy lavon julian do (add pictures please)
A: Medicines are designed to treat illnesses and medical conditions. They help to alleviate symptoms,…
Q: QUESTION 22 Which compartments are topologically equivalent with the nucleus? OA. ER and…
A: Introduction :- The nucleus is a membrane-bound organelle found in eukaryotic cells. It houses the…
Q: Multiple choice: 2. Where are the primary afferent axons conveying mechanosensory signals from the…
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: Expressed genes are found in: euchromatin DNA that is tightly packed centromeres…
A: A gene is a segment of DNA (deoxyribonucleic acid) that contains the instructions for the…
Q: Normal pigmentation in humans is completely dominant to albinism. A couple who are both carriers for…
A: Albinism is a group of inherited genetic disorders characterized by a lack of melanin, the pigment…
Q: explain how the hypothalamus and the pituitary gland work together and how they control other…
A: The pituitary gland is often called as “master gland” because its hormones control other parts of…
Q: how do steroids/sterols chemical structure help with identifying lipids?
A: Introduction :- Steroids and sterols are a type of lipid that have a unique chemical structure that…
Q: How many ovaries are there in a flower with a compound pistil containing 10 carpels?
A: A pistil is the female reproductive system. The ovary which holds the potential seeds or ovules is…
Q: hi can you please help me review this vedio including vedio topic presented, the information…
A: Bioterrorism refers to the deliberate release of biological agents such as viruses, bacteria, or…
Q: D. A. B. 10. C. Familial hypercholesterolemia is the most common genetic cause of heart disease. It…
A: We need to understand the basic concepts of genetics and also consider how these traits are…
Q: If a cell is aneuploid, do you expect it expresses a higher level or lower level of proteins than…
A: Introduction : Aneuploidy is a type of chromosomal abnormality, where there is one excess…
Q: How does guided participation help children learn based on the sociocultural perspective? Children…
A: Participation in any creative activities is always good for both mental and physical health of the…
Q: Will glycolysis be useful for the metabolism of acetate? (Yes or No) 2. When grown aerobically,…
A: Introduction Respiration is the process through which all living things, including people and…
Q: Question 10. How do RabGTPases contribute to vesicle targeting? A. They tether vesicles to the…
A: Introduction: The process by which vesicles (small membrane-bound sacs) move within cells to…
Q: Make a table of the cranial nerves VI, VII, VIII, IX, X including the general and specific function…
A: Cranial nerves are a group of 12 nerve pairs that originate in the brain and control functions in…
Q: 6. Draw a simple graph that illustrates the general relationship between organism size and…
A: Population is the term usually used to refer to the number of individuals in a area and the number…
Q: Which one of the following mutations to the coding region of a gene would change the codon reading…
A: A mutation is a change that occurs in the genetic material (DNA) of an organism. Mutations can occur…
Step by step
Solved in 2 steps
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThe bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGATranscribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 805'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G