One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
Q: What are the bonds that hold the backbone of each DNA strand together called?
A: A DNA strand is made up of multiple nucleotides.
Q: If the nucleotide sequence of one strand of DNA is 5′ ACGTTGCA 3′, what is the sequence of the…
A: In molecular biology, the DNA is made of two complementary strands which runs antiparallel to each…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: what is the adenine content
A: In double-stranded DNA, 3 hydrogen bonds form between guanine and cytosine and make them a pair. On…
Q: If you are given the DNA sequence: T-A-C-G-G-T-C-A, determine the complimentary DNA strand.
A: DNA is the molecule which stores the genetic information in an organism that makes the nucleotide,…
Q: A double-stranded molecule of B DNA contains 340 nucleotides. How many complete turns occur in this…
A: DNA duplex model proposed by Watson and Crick is right-handedly coiled and is called B-DNA. A DNA…
Q: DRAW A DNA STRAND WITH 10 ADENINE BASES FOLLOWED BY 10 CYTOSINE BASES. IF THAT SAME STRAND BONDED TO…
A: Deoxyribonucleic acid (DNA) is a double helical structure, which is composed of nucleotides. The two…
Q: If one DNA strand is 5′–GGCATTACACTAGGCCT–3′, what is the sequence of the complementary strand?
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: How many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if…
A: A DNA nucleotide is composed of five-carbon sugar called deoxyribose, a phosphate group, and one of…
Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…
A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…
Q: If one DNA strand is 5′–GATTCGTTC–3′, what is the complementary strand?
A: Complementarity in the strands of DNA is referred to as a lock-and-key relationship between both the…
Q: H. HD N. A N- H- H. 0=P-0- CH2 H. H. H. OH) H B. Where would this nucleotide hydrogen-bond to its…
A: Each nucleotide is a monomer of nucleic acid such as RNA and DNA. The RNA and DNA differs from each…
Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?
A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…
Q: What is the complementary strand of the following DNA strand?
A: The type of nucleic acid present in the nucleus of the cell is deoxyribonucleic acid or DNA. It is…
Q: The two strands of DNA in a double helix are ______________.
A: The DNA is the genetic material of most of the organisms. It is a a polymer of nucleotides that…
Q: What would be the most obvious characteristic of the base distribution of a single-stranded DNA…
A: DNA of a virus has a genome made of deoxyribonucleic acid (DNA) that is replicated by a DNA…
Q: If a double-stranded DNA molecule is 15% thymine, what are the percentages of all the other bases?
A: The deoxyribonucleic acid is the genetic material that is passed from one generation to another…
Q: If one side of DNA molecule had a base sequence of…
A: DNA or deoxyribonucleic acid, the major genetic material, is a polynucleotide chain made of…
Q: If an RNA strand generates its complementary strand, thus producing a double helix, will a molecule…
A: Nucleic acids are the main information carrying molecules of the cell and by directing the synthesis…
Q: What is the nucleotide sequence of the complementary strand of the DNA molecule:…
A: Nucleic acids are large macromolecules that store hereditary information for cellular growth and…
Q: A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine containing…
A: Introduction: DNA (deoxyribonucleic acid) is the molecule that transmits genetic codes for an…
Q: If a double stranded DNA HAS 20 PERCENT OF CYTOSINE, calculate the percent of adenine of adenine in…
A: According to Chargaff's rule, A = T and G = C, as adenine (A) binds with thymine (T) and guanine (G)…
Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…
A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…
Q: Create the complementary strand for the DNA strand. ATTTGGTT
A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…
Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…
A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…
A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…
Q: If one strand of DNA has the sequence A-A-C-T-G-T-G, what will be the nucleotide sequence of the…
A: DNA replication is the process of formation of DNA without using its own template . This process…
Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…
A: Answer
Q: If one strand of a DNA molecule has the base sequence 5′-AGCATTAAGCT-3′, what is the base sequence…
A: The complementary base pairing rule or Chargaff’s rule states that the DNA base pairs are always…
Q: If one strand of the DNA double helix consists of T-C-G-A-T-G-T-A, what is the sequence of the…
A: Introduction DNA ( Deoxyribonucleic acid) and RNA( ribose nucleic acid). These are the nucleic acids…
Q: What is the melting temp. of the following double-stranded DNA fragment…
A: Melting temperature formula : Tm = 4* (G+C) + 2 * (A+T) Number of G+C = 6 Number of A+T = 20
Q: If one of the strands of DNA has the following sequence of bases running in the 5-S3'…
A: The given strand is: 5'-G-G-A-C-A-A-T-C-T-G-C-3` The complementary strand for the given sequence is:…
Q: Draw this stretch of DNA, showing BOTH strands, using a simplified model of a nucleotide as shown:…
A: DNA is the protein in all living organisms that convey genetic information.
Q: Using the codon chart, if the DNA strand being described is AGG TCT GAT , the resulting amino acid…
A: The order in which amino acids are found in a protein. Proteins are made up of 20 different types of…
Q: Name the bases in the pentanucleotide with the sequence G-A-U-C-A. Does this come from RNA or DNA?…
A: The nucleic acids Deoxyribose sugar (DNA) and Ribose sugar (RNA) are nucleotides that are made up of…
Q: To determine: The base sequence of complementary strand if a DNA molecule has base sequence…
A: DNA was identified in the nucleus in the late 1860s by Friedrich Meischer, but its function was…
Q: What type of DNA helix spirals to the left and the backbone takes on a zigzag shape?
A: Deoxyribonucleic acid (DNA) is the genetic material of the majority of the organisms.
Q: The template strand of a double helical segment of DNA consists of the following sequence: 5’-…
A: Hi! Thank you for the questions. As you have posted questions with multiple subparts, I will be…
Q: Type the matching bases in each DNA sequence. G A T A G C T A G G
A:
Q: Match the correct bases pairs to find the opposite strand of DNA strand of DNA - T G C…
A: DNA is deoxyribonucleic acid. It is the genetic material which is double stranded, which means it…
Q: If the sequence of base pairs on a DNA molecule are AGATTAGTG, what is the sequence on the…
A: Deoxyribonucleic acid (DNA) is a molecule made up of two polynucleotide chains that coil around each…
Q: A strand of DNA has the specific sequence ATGGCTA. What would be the sequence of a complimentary…
A:
Q: What is known synthesized DNA is called the leading strand?
A: The hereditary ingredient in the cell is the genetic material. DNA is present in the nucleus of…
Q: How many hydrogen bonds exist between this DNA strand and its complementary strand?
A: DNA stands for Deoxyribonucleic acid. It acts as the genetic material in all living organisms. It is…
Q: If one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite…
A: DNA is the genetic material that involves the transfer of information from one generation to the…
Q: In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where…
A: DNA is composed of nucleotides which form its building blocks. Each nucleotide comprises a…
Q: If the template strand of a DNA is 3’-ATCATG-5’, what will be the complementary strand?
A: A nucleotide is a bio molecule that consist of a nitrogenous base, a pentose sugar (deoxyribose in…
Q: If a region of one strand of a DNA double helix has the sequence 5'-CAGATAC-3', what is the sequence…
A: The nucleotide base pairing is complementary that is two complementary nitrogenous molecules are…
Q: The nucleotide sequence of one DNA strand of a DNA double helix is 5’-GGATTTTTGTCCACAATCA-3’.What is…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 3 images
- What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence.Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAA
- For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandHere is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?There is a chemically synthesized DNA oligonucleotide is 5’–AUCG–3’. Pleasedraw the all-atom structure of this RNA strand, including that of the phosphategroup, the pentose (ribose), and the base for each nucleotide. The structure is inthe 5’→3’ direction
- Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of DNA with the following base sequences: 5'CGGAC3'One strand of a double-helical DNA has the sequence (5′)GCGCAATATTTCTCAAAATATTGCGC(3′). Write the base sequence of the complementary strand. What special type of sequence is contained in thisDNA segment? Does the double-stranded DNA have the potential to form any alternative structures?If I tell you that a stretch of DNA in the 5' to 3' direction is AGGTACGACCGT Give me the complimentary strand without and spaces, commas, symbols or anything else besides the nucleotide sequence (e.g. only: AAGCATCCGCTTA). Give me the complimentary sequence in the 3' to 5' orientation.
- Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA TGTGCGCGCGGGGCGPermutation is the ordered arrangement of m number items out of a list of n items. For instance, the DNA strand with sequence of 3 bases: G-A-C IS different w ith A-G-C, C-A-G, G-C-A, A-C-G, and C-G-A. From this, we have: P-3) 3! 3x2x1 Therefore, there are 6 dıfferent sequences of DNA strands that can be formed out of 3 given bases. In general, we have this formula for permutation: (n-m)! Count the number of ways in which: Guanıne, Adenine, Cytosine, Thymıne, Cytosine, and Guanıne (6 bases) be sequenced in one DNA strand?As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________