MUTATION-BASE ADDITION Add a "C" just before the 14 base of the DNA. Then fill out the chart Normal Unzipped DNA strand T A C A A A G A A A T A A A T mRNA strand anti-codon on tRNA amino acid What effect does this have on the DNA? What effect does this have on the mRNA? The protein structure?
Q: A eukaryotic cell has a mutation that prevents mRNA from leaving the nuclear envelope. What result…
A: mRNA, or messenger RNA, is a type of RNA molecule that plays a crucial role in gene expression. It…
Q: Which organism produces the naturally derived antibiotic O E. coli O P. polymyxa OS. epidermidis
A: Antibiotics are chemicals/ substances that inhibit the growth of bacteria. These are used against…
Q: DNA ligase seals the gaps between DNA fragments +RNA primers are removed by DNA polymerase I and…
A: DNA replication is a fundamental process that occurs in all living organisms, allowing for the…
Q: Review the discussion of evolution and the Investigating Life feature. Which of the following…
A: Moth collect mainly the orchid nectar as food. The orchid nectar helps in nutrition of moth. So it…
Q: Provide a detailed, written explanation of the plasma membrane structure explaining both composition…
A: Plasma membrane is the outer boundary of a cell that regulates the entry and exit of different…
Q: Could you provide a rundown of the numerous infections and their consequences?
A: Infections are a common occurrence in the realm of human health, caused by a wide range of…
Q: Mutations caused by carcinogens such as solar radiation accumulate in skin cells over a person’s…
A: The question portrays a situation in which mutations caused by carcinogens such as solar radiation…
Q: Match the types of bonds to their definitions. lonic Bond Polar Covalent Bond Nonpolar Covalent Bond…
A: The ability of an atom to draw electrons into a chemical connection is known as electronegativity.…
Q: Which of the following regions within a mRNA sequence indicates the start of translation? O a.…
A: Translation is a fundamental biological process wherein the genetic information encoded in the…
Q: Explain how to conduct an investigation to extract DNA from a specimen of an animal Make sure to…
A: The genetic codes necessary for the growth, operation, and reproduction of every living creature are…
Q: If a SNP is found much more frequently in dogs with white fur than in dogs with black fur, the SNP…
A: Single nucleotide polymorphisms (SNPs) in GWAS are essential for understanding the genetic…
Q: Using our class population data above, answer the questions below. 1. Were you surprised by any…
A: The given data discusses the dominant and recessive phenotypic ideas, their predominance within the…
Q: How is mitosis different from meiosis in terms of the resulting daughter cells? list 2. What is…
A: In eukaryotes, there are basically two types of cell divisions which are mitosis and meiosis.…
Q: 4 5 A 2 3 How is '1' in the above leaf anatomy image modified in a xeromorphic leaf?
A: Xerophytes are plants that are adapted to live in dry places like deserts. Example: Cactus. Since…
Q: Explain what is going on at sites A, B, C, D, F and G in relation to CHARGE (negative, positive,…
A: Action potentials are electrical impulses that neurons use to interact with one another. The…
Q: Why are biologic systems such as red blood cells and guppies susceptible to osmotic injury? They are…
A: Osmotic injury is the osmotic shock or osmotic stress. This is special type of physiological…
Q: vs. size Interpret the results shown on the graph below which shows b generation ibition zone in 3…
A: When a bacterial population is subjected to any antimicrobial substance or a chemical, bacteria die…
Q: In some types of colon cancer, stem cells have a mutation in the APC gene. What happens if the APC…
A: Colorectal cancer is a common type of cancer that affects the colon or rectum. It is also known as…
Q: write an article on Cryptosporidium a pathogenic eukaryote parasite. What is the natural habitat…
A: Cryptosporidium is a pathogenic eukaryotic parasite that poses a significant threat to human and…
Q: A dominant phenotype you are studying is present in 8.25% of people in a population you are…
A: The principal, Hardy-Weinberg equilibrium states that the genetic variation in a population will…
Q: The Kirby-Bauer method uses a plastic strip with a concentration gradient of an antibiotic called an…
A: Kirby-Bauer assay of idenfication of bacterial strain is either resistant or susceptible to a…
Q: A (Only zygotes with balanced genomes will survive to adulthood. What proportion of F1 zygotes have…
A: A unique organism with an intriguing genetic configuration evolved from a population of Drosophila…
Q: If you had additional hearts distributed throughout your body, what would be one likely advantage…
A: The circulatory system would be profoundly altered if humans had numerous hearts scattered…
Q: If want to express the gene from monkey, the PET vector or BACMAN would be best? Briefly explain
A: The decision between PET and BACMAN vectors for expressing a gene from a monkey depends on several…
Q: Table 3. Common Single Gene Cha
A: Genoypes can be ascertained by either puting the same two alleles together that is this would be the…
Q: Chemicals that may be sterilants are called
A: High level germicides are a category of chemicals that have the ability to kill a wide range of…
Q: Each of the following describes a distinctive step in a genomic technology or experimental design.…
A: Answer.) :- Genomic technology and experimental design have revolutionized our understanding of…
Q: Conifers
A: Abies pinsapo, commonly known as the Spanish fir or Pinsapo fir, is a species of coniferous tree…
Q: Write the steps involved in simple staining ? And what the purpose of doing it ?
A: It is a conventional staining technique. The method only uses a single stain and is a direct…
Q: Suitable hypothesis that will predict answers for the following: A) what is the rate of germinating…
A: An explanation or claim that is put forth as the foundation for more research or testing is called a…
Q: The following reactions are all antigen(Ag)-antibody(Ab) complexes. Match the description with the…
A: Antibody-antigen reactions like precipitin and agglutination involve antibodies binding to soluble…
Q: present case studies of biotechnology implementation in Belize Agriculture, highlight specifc crops…
A: Biotechnology has revolutionized agriculture globally, including in Belize. Through the application…
Q: 4. The UWC Biotechnology 213 class undertook a study to determine the microbiological quality of…
A: Given: 25gram minced sample in 225ml Ringers' solution. So the dilution is 1 9, so it is the Final…
Q: Which of the following statements about genetically modified organisms (GMOS) are correct? Select…
A: The following statements about genetically modified organisms (GMOs) are correct:Transgenic bacteria…
Q: 83. Due to their low density, females of a species of turtles are having difficulty finding mates.…
A: Mate availability is a critical factor in reproductive success. When individuals fail to find mates,…
Q: Give typing answer with explanation and conclusion It is often said that “an allele that results in…
A: Charles Darwin proposed the idea of natural selection which is the foundation of current…
Q: Draw a labelled diagram to support the basic transcription steps
A: Transcription is the method of replicating hereditary data held in DNA into RNA. This process takes…
Q: A GWAS is done comparing squirrels with spots to those without. Answer the following questions about…
A: It is Manhattan GWAS plot.The results of genetic association studies are shown graphically in GWAS…
Q: Which of the following is NOT a function of the placenta? Question 23 options: To supply the…
A: By unraveling the intricacies of the placenta, we can gain a deeper appreciation for the remarkable…
Q: (i) A repressor binds to RPA and an activator binds to RPC 1. [Select] 2. [Select] 3. [Select]
A: Gene expression, the process by which information from a gene is used to synthesize a functional…
Q: A 53-year-old woman calls the office reporting that she noticed last evening that an area in her…
A: Follow office policy to ensure the correct course of activity whereas reacting to a call from a…
Q: Describe the basic pathway of information flow through neurons that causes you to turn your head…
A: Nervous system in the human body involves in coordination and control various types of activites.…
Q: If you had additional hearts distributed throughout your body, what would be one likely advantage…
A: The circulatory system would be altered if humans consists of many hearts distributed throughout…
Q: Please answer asap and type your answer and do not copy from anywhere please 1. In order to ‘drive’…
A: It's critical to comprehend the many ways and elements at play while talking about spore staining…
Q: How many amino acids long is the protein below? PRO CYS GLU MET HIS LYS ALA STOP
A: The construction, operation, and control of cells and tissues of living creatures depend on…
Q: Describe how the immune responses to bacteria and viruses differ, making sure to refer to the…
A: First line of protection against germs and viruses is the innate immune response. It offers a quick,…
Q: Q16. A mother and father with normal vision have a colorblind Klinefelter son. Colorblindness is an…
A: When a male develops Klinefelter syndrome, he has an additional X chromosome, which causes his…
Q: 3. 4. Draw a picture of a ten-fold serial dilution. Please use 10ul ( 9ml of solution. Show a…
A: It is a series of succeeding dilutions that performed to reduced concentration of a microbial…
Q: Select all that apply: What are some natural sources of antibacterial drugs? O Prions O Molds…
A: Some sources of antibacterial drugs are : Bacterias Molds
Q: After the extinction of the dinosaurs, the next major group of primates to arise Group of answer…
A: Evolution is the progressive change in a species' features over a number of generations that depends…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 2 images
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’ Transcribe the template strand be sure to use the 5’ and 3’ directions appropriately on the mRNA, feel free to rewrite the DNA strand if needed to make it easier to interpret. Make sure to label the mRNA with a "5'cap" and place 10 A's to form the poly-A tail.PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
- Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- Name: Date: 2. The sequence of a fragment of one strand of DNA is AATTGCATATACGGGAAATACGACCGG. Transcribe this s sequence into MRNA. er bns eldst eboo oi ebitqeqylog erlt to noihiog eri qu elsm bluow tsri abios onime Jlaw as ye s 1ot noitem atelomet AHG 3. The following MRNA ştrand is being used to asemble a polypTemplate strand: 5' AATCATAACTCATTG 3' A. Write the CODING strand of this sequence, including the 5' and 3' end designations. B. Write the amino acid sequence coded by this mRNA. The start codon is the first codon in the sequence that codes for Met. First position (5'-end) U < G บบบ UUC phe UUA UUG CUU Couleu CUC Coc CUA CUG AUU AUG AUC ile GUU GUC GUA GUG Second position C UCU UCC UCA UCG val CCU co CCC CCA 000 CCG ACU ACC ACC AUA ACA thr AUA ACA AUG met ACG GCU GCC ser GCA GCG pro ala UAU ORD tyr UAC UAA Stop UAG Stop CAU CAC CAA CAG - AAU AAC www AAA 10 asn AAG 7 his GAU GAC GAA GAG gin }| lys asp glu UGU UGC cys UGA Stop UGG trp CGU C00 CGC CGA 000 CGG AGU AGC ACA AGA AGG GGU GGC GGA GGG Initiation Termination arg ser arg gly DUAL SUAU DUAU DUAG Third position (3-end)Mutated DNA Sequence #1 TACAT C TTG C G A C GAC T... What's the mRNA sequence? (Circle the change) amino acid sequence? Will there likely be effects? What type of mutation is this?
- Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C TWhat’s the mRNA sequence?What will be the amino acid sequence?What kind of mutation is this?Will there likely be effects?Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Mutated DNA Sequence #2: T A C G A C C T T G G C G A C G A C T What’s the mRNA sequence? (Circle the change) What will be the amino acid sequence? Will there likely be effects? What kind of mutation is this?