Mutation Activity Worksheet Transcribe the original DNA strand to RNA codons, then use Table 5.4 on page 134 in the textbook to determine amino acids. Compare the original DNA strand to each mutation to determine what type of mutation has occurred. Original DNA Strand: TAC CAT GCA ATG ACT mRNA codons: Amino Acids: Compare the original DNA strand to Mutation #1 Mutation #1: TAC CAC GCA ATG ACT mRNA codons: Amino Acids: What kind of mutation is this? Compare the original DNA strand to Mutation #2 Mutation #2: TAC CAT CCA ATG ACT mRNA Amino Acids: What kind of mutation is this? Compare the original DNA strand to Mutation #3 Mutation 3: TAC CAT GCA ATC ACT mRNA Amino Acids What kind of mutation is this? Compare the original DNA strand to Mutation #4 Mutation 4: TAC CCA TGC AAT GAC TAG mRNA

Mutation Activity Worksheet Transcribe the original DNA strand to RNA codons, then use Table 5.4 on page 134 in the textbook to determine amino acids. Compare the original DNA strand to each mutation to determine what type of mutation has occurred. Original DNA Strand: TAC CAT GCA ATG ACT mRNA codons: Amino Acids: Compare the original DNA strand to Mutation #1 Mutation #1: TAC CAC GCA ATG ACT mRNA codons: Amino Acids: What kind of mutation is this? Compare the original DNA strand to Mutation #2 Mutation #2: TAC CAT CCA ATG ACT mRNA Amino Acids: What kind of mutation is this? Compare the original DNA strand to Mutation #3 Mutation 3: TAC CAT GCA ATC ACT mRNA Amino Acids What kind of mutation is this? Compare the original DNA strand to Mutation #4 Mutation 4: TAC CCA TGC AAT GAC TAG mRNA

Name: Mutation Activity WorksheetTranscribe the original DNA strand to RNA
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Mutation Activity WorksheetTranscribe the original DNA strand to RNA codons, then use Table 5.4 on page 134 inthe textbook to determine amino acids. Compare the original DNA strand to eachmutation to determine what type of mutation has occurred.Orig

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

RNA Transcription, Translation, and Mutation Worksheet First, here is a strand of DNA. This strand contains both a gene and its promoter region. Circle the promoter region in blue, draw a yellow box around the TATA box, draw a green box around the start codon, and draw a red box around the stop codon: TATATATATTACGTTGCATACGCTCAACGGTCGAAACTGCATGGGCAC ATATATATAATGCAACGTATGCGAGTTGCCAGCTTTGACGTACCCG Now imagine this gene has been transcribed into RNA. What would that RNA strand look like? Before the above RNA strand can be translated, a few modifications must first take place (in eukaryotes). What are they? 1) 2) 3) Using a codon chart of your choice (one can be found here, or here) translate the above RNA transcript (assume no splicing took place). Write the three letter abbreviations for the amino acids in the image below: Now imagine that a mutation took place in the original strand of DNA (marked in red) TATATATATTACGTTGCATACCCTCAACGGTCGAAACTGCATG…
Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
Cynt Classifying mutations A certain section of the coding (sense) strand of some DNA looks like this: $-ATGTATATCTCCAGTTAG-3" It's known that a very small gene is contained in this section. Classify each of the possible mutations of this DNA shown in the table below. mutant DNA 5- ATGTATCATCTCCAGTTAG-3' S-ATGTATATCTCCAGTTAG-3 5- ATGTATATATCCAGTTAG-3' type of mutation (check all that apply) insertion deletion point silent noisy insertion O deletion point silent noisy insertion O deletion point silent Onoisy X G
Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3
Instructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…
Adec ct L AA AAe mo LAe AaB A Exercises: Directions: Complete the following lines for frame shift mutations. Write each codon on the line provided and below it identify the specific amino acids the codon coded for. DNA Sequence: ATG ATA GAA CCG GGT TAC CAT CGT GAT AGA 1. Insertion: ATG ATA Insert a nitrogen base 2 Deletion: ATG ATA GAA Delete a nimogen base REVISED KNOWLEDGE: Actual answers to the process questions/ focus questions I 1. Why is the base pairing in DNA important? Complementay base pairing is important in DNA as it allows the base pairs to be arranged
08 Nucleoside and nucleotide analogs are two closely related classes of anti-viral drugs that inhibit viral DNA or RNA polymerase enzymes. What is their most common mechanism of action and why are they often referred to as "chain terminators"? Edit View Insert Format Tools Table A xd0 Paragraph v They are referred as chain terminators because the sturcutre when looked at does not contain a 3 prime end 31 8 8:10 EE O 6 n
Original DNA DNA Protein TACGCTATGAGC Methionine-Arginine-Tyrosine-Serine Mutation #1 DNA What type of mutation occurred? substitution insertion duplication deletion TACTCTATGAGC
Format Tools Add-ons Help Last edit was seconds ago Arial BIUA Normal text 11 1 3 Which of the following molecules|are involved in gene expression? Choose all that apply. O RNA polymerase O Splicing O Primer O Origin O Stop codon O Start codon O Parental strand O IRNA O Okazaki fragment O Bubble OFork O Leading strand O Helicase O DNA polymerase OA site O Amino acid attachment site O Primase O Primer O Terminator sequence MAY 18 étv A MacBook Air
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
QUESTION: Transcribe the gene. Write out the correct sequence of m RNA bases. Notice that this is the same gene as in B above. Recall that in RNA, thymine (T) does not exist and uracil (U) takes its place. 3' ССА TAG CÁC CTT GTC ACA ACG TGT TCG TAG ACA 1 3. 4. 6. 7. 8. 9- 10 11 AGG AAC АТА ATA GTT AAC CTT TTG ATA ACA ТТА ACT 12 13 14 15 16 17 18 19 20 | 21 in