Match the subfamilies of HSPGS withe their examples v syndecans and CD44V3 A. GPI-linked proteoglycans v glypicans B. Membrane-spanning proteoglycans v perlecan and collagen XVI C. Secreted ECM proteoglycans v agrin
Q: E Which choice best describes the location of the majority of the musculo-skeletal system? A. It is…
A: Introduction Bones, muscles, tendons, ligaments, and soft tissues make up the musculoskeletal…
Q: born with sickle cell anemia. What is the frequency of individuals in this population who do not…
A:
Q: Question 9 The mechanism for all template-directed synthesis of any type of nucleic acid involves…
A: Template strand The template strand is the strand of DNA which replicate itself during the process…
Q: MULTIPLE CHOICE QUESTION Which of the following is not an example of homeostasis? Chenging…
A: Homeostasis is the phenomena occuring in the living body where constant condition is maintained…
Q: Question 48 The energetic driving force for the synthesis of the new strand is the removal of the…
A: Removal of pyrophosphate group yields energy which is then diverted to the formation of new strands…
Q: The VPg protein from picornaviruses has which of the following function? O a. It packages the viral…
A: Picornaviruses are viruses that infect fishes, mammals, and birds. These group of viruses are…
Q: Use what you know about inflammation to explain how periodontal organisms might be responsible for…
A: Suppose that bacterial plaque builds up in patient's oral cavity (on the teeth). This leads to…
Q: The adaptive response is a robust and critical component of the immune systemis able to combat…
A: The immune system It is a group of cells, substances, and processes that help protect the skin,…
Q: Optimal DNA replication requires the coordinated effort of all the following EXCEPT: A single strand…
A: Single stranded binding proteins prevent single stranded DNA from exonuclease activity during…
Q: 1. What are advantages of nanotechnology in medicine and agriculture?
A: Introduction Nanotechnology:- It is the manipulation of materials on an molecular or atomic scale…
Q: Question 1: You suspect that a patient has sepsis. A. What type of specimen would you collect to…
A: *NOTE: Kindly repost for other question Dear Student as per the guidelines we are supposed to answer…
Q: Briefly discuss Mendelian Inheritance with that of crossing-over.
A: The Mendelian genetics gives us idea about the inheritance of genetic materials from the parents to…
Q: energy flow differently in island pyramids vs landscape pyramids? Is the recycling of matter more…
A: The pyramid of energy depicts the flow of energy from one trophic level to another trophic level. It…
Q: Rowena was tasked to measure the actual magnification of her specimen mounted on a slide without…
A: A simple microscope is a magnifying glass with a short focal length and a double convex lens. The…
Q: what is the relationship between genes and traits expressed in individuals? a) gene code for DNA,…
A: Every living organisms contain DNA as the genetic material. In case of eukaryotic cells the DNA is…
Q: 1_Vancomycin inhibits cell wall synthesis by: a.Binding irreversibly to transpeptidase and inhibit…
A: Vancomycin inhibits cell wall synthesis in gram-positive bacteria by binding firmly to the…
Q: Task 2 Week 15 4. FIGURE 4 shows sugar transport in phloem. Phloem A В 888 Source cell $8888 Sink…
A: Introduction The movement of materials across cell membranes is referred to as cell transport.…
Q: 1. Why has the hoatzin earned the nickname, "stinkbird? 2. Hoatzin chicks have unusual features…
A: As per Bartleby guidelines experts area allowed to answer only 3 sub-parts for given question.…
Q: The normal sequence of nine genes on a certainDrosophila chromosome is 123 • 456789, where the…
A: The basic karyotype of Drosophila melanogaster, which is observed mitotically comprises active…
Q: According to the recent malaria report of the Department of Health, Disease and Prevention Bureau…
A: The malarial parasite passes its life cycle I'm two different host's. The man is the intermediate…
Q: Cite 4 important Glycobiology applications or studies
A: Introduction - Glycobiology is the study of carbohydrates, also known as glycans, and their…
Q: Compare the prevalence of neglected tropical diseases to the much better known and deadlier…
A: * Non Tropical Diseases can be found in countries like Africa and Asia, and Latin America and…
Q: Q4 - What are two features of your protein's (Phosphoenolpyruvate carboxykinase, PCK1) structure…
A: Answer-4 A protein is a normally occurring, extremely complex substance that consists of amino acid…
Q: Which of the following is true of TATA boxes? I. they are found within the core sequence of a gene…
A: * TATA box is a part of DNA sequence where genetic sequence will be read and decoded. *It is one…
Q: Q4.3. After the rising phase, which ion channel is responsible for action potential returning to its…
A: Introduction An action potential is a rapid rise or an explosion of electrical activity and…
Q: How to detect cancer? What are a few approaches to treat cancer?
A: Cancer can be detected in its early stages, and early detection is critical for successful…
Q: A potato cube is placed in a solution. The volume of the potato increases. which statement below is…
A: Osmosis is a process of flow of solvent molecules from lower concentration to higher concentration…
Q: What is Pepsin
A: Digestion of food begins inside the mouth with the help of the enzyme salivary amylase and digestion…
Q: Match the organs with their functions pancreas a. production of saliva b. secretes pancreatic juice…
A: The Digestive System: The digestive system breaks down the food into smaller pieces so that it can…
Q: Which statement is false when considering alleles and gene
A: An allele is a part of the gene. Generally, two alleles make one gene. Based on the presence of the…
Q: Species richness quantifies the amount of money each species is valued at on the biodiversity stock…
A: Species richness quantified?
Q: TACTGCCTCCCCATAAGAATT
A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…
Q: a. The scale of a spectrophotometer extends from 1 to 100% T, what are the values of these two…
A: Ans a. Absorbance of these two extremes from percent transmittance ( %T) can be calculated by the…
Q: Which of the following is/are the contents of the ventral cavity? A. heart and lungs B. brain and…
A: Introduction - The anterior (front) part of the human body has a cavity called the ventral body…
Q: f you lost your ability to walk, could you access all of your house? What would need to change?…
A: Whenever one loses their ability to walk, they become wheelchair bound. Hence, their house, car…
Q: A cross between plants having seed character RRY (round, green) and rrYY (wrinkled, yellow) will…
A: A Dihybrid cross is a cross between two individuals with two different traits. These two different…
Q: Defining occupational health and safety and its importance in the work environment.
A: occupational health deals with all aspects of health and safety in the workplace and has a strong…
Q: Microorganism A was exposed to different constant temperatures to get the specific D- values.…
A: The z-value is a measure of the change of the D-value with varying temperature, and is a simplified…
Q: List two possible missense mutation effects on the new polypeptide.
A: *missense mutation occurs when there is change in a single base pair that causes substitution of…
Q: Synthetic opioids are frequently being used for analgesia, i.e. as pain killers. While morphine or…
A: * Synthetic opioids used for analgesia as pain killers. *morphine and other agonists like fentanyl…
Q: A 3-point test cross produces the following numbers of offspring: The yellow cells are the…
A: The three point test cross data is given in the question. The three genes are involved in a three…
Q: 12. Below is a diagram of a cell. Which of the following is true? a. The cell is a plant cell,…
A:
Q: Match the description on the left side to the correct term from the choices on the right side.…
A: The living world comprises of the plants, the animals and the microorganisms which we cannot see…
Q: Which of the following helps Human sperm with locomotion? a) Flagellum b) Basal body c) Nucleosome…
A: Sperms are the male gametes produced in the seminiferous tubule present in testicular lobules.…
Q: What is the genetics/chromosome number of Podocarpus costalis? What is the phenology and…
A: The genus Podocarpus sensu latissimo (s.l.) was initially subdivided into eight sections. these…
Q: The International Union for the Conservation of Nature and Natural Resources (IUCN), has declared…
A: Some of the conservation strategies adopted by wildlife conservation in the Philippines are the…
Q: Division of human egg is a) Holoblastic and equal b) Holoblastic and unequal c) Isoblastic d)…
A: Introduction - One of the largest cells in the human body is the human egg, or ovum. It is, however,…
Q: Adaptive radiation is when populations diverge from a common ancestor into new species, each of…
A: Adaptive radiation/ convergence is a phenomenon in which populations can undergo two processes:-…
Q: An extinction vortex describes a) changes in a population’s gene pool that lead to a loss in…
A: Answer- a) changes in a population’s gene pool that lead to a loss in fitness across time
Q: The study of the b-globin gene helped establish the one gene-one polypeptide relationship. Which of…
A: Mutation is a random process. It leads to change the nucleotide in a sequence of a gene.
Step by step
Solved in 2 steps with 1 images
- diagram of the chain of infection for COVID-19c) pien Nutriceutical Give examples of medications prescribed in alternative medicine. Is it necessary to take precautions in the use of Such medicines? Explain. What natural products are being explored as prospective protection or treatment against Covid-19? Elaborate on each very briefly why they are considered as such. Corabree1 of 16 Data from an experiment is shown in the figure below. In the experiment, murine cells were treated with a specific a ligand that activates receptor R. In some cases, the cells were exposed to one of two drugs (X or Y) as well as the ligand or were left untreated (UT). After 30 minutes of treatment, the cells were lysed with a detergent-based buffer to release the soluble membrane, cyosolic and nuclear proteins. Samples from each cell extract were run (in duplicate) by SDS-PAGE (SDS-polyacrylamide gel electrophoresis) in order to separate the proteins by molecular mass (size). The separated proteins were then transferred to a nitrocellulose membrane which was then probed with different antibodies in a western blotting procedure to detect specific phosphorylated proteins or total proteins. If present in the cell extract, these proteins appear as a dark band in the relevant western blot image within the figure. Drug X Drug Y UT Ligand Ligand Ligand Western blotting antibodies…
- Give an example of how signal transduction plays a role in disease help this is a biochemistry for my last hw. he is very detailedMicrotubule stabilisers may be used as anticanceragents. Propose a set of four molecules from the literature that can be overlaid to give a commonpharmacophore. Label the key structural featuresthat indicate some similarity between themolecules.PDGF 100 PI3K 740 751 PI3K 50 - GAP O771 O GAP PTP P 1009 O PTP protein P-site 1 12 4 5. 6. 7. PI3K 740, 751+ 1021 GAP 771 +] +] PTP 1009 PLC PLCy PLCT 1021 When activated by ligand binding, the PDGF (platelet-derived growth factor) receptor becomes phosphorylated on 5 tyrosine residues (left figure). These phosphorylated tyrosines serve as binding sites for proteins that contain SH2 domains (SH2 domains bind phosphorylated Y). These proteins include phospholipase C-gamma (PLC-gamma), a phosphotyrosine phosphatase (PTP), a Ras GTPase-Activating Protein (GAP), and a phosphotidylinositol 3-Kinase (PI3K). PDGF stimulates several changes in the target cell, one of which is DNA synthesis. To determine which effectors of the PDGF receptor is/are responsible for stimulating DNA synthesis, you construct several mutant forms of the receptor that retain individual or combinations of the phosphorylation sites. You express these in cells and monitor DNA synthesi The results are shown in the right…
- Why covid19 binds to Ace receptors only? Describe it's mechanism of infecting the cells?Specific inhibitors of dyneins have yet to be discovered. When they are discovered, how would they most likely affect cells? Reduce retrograde transport of endosomes Decrease pseudopod formation in amoeboid cells Increase cell size Decrease contraction of skeletal muscleExplain the NF-KB pathway and the interaction between it and COX and interleukins in the inflammatory repsonse process in regards to adenocarcinoma tumours colon cancer.
- Which is true about Creutzfeldt-Jacob disease? Select all that apply. O it is caused by a prion O It is caused by an abnormally folded protein O Normal proteins are induced to begin folding abnormally, resulting in progression of the disease It affects brain tissue [ It is always fatal), create a simple flowchart depicting the MC1R pathway. There should be a minimum of five steps in the pathway. Be sure to include reception (protein binding to its ligand), a portion of the transduction pathway (what’s the intracellular reaction? What molecule works intracellularly?), and the cellular response (What’s produced from the cell?).Explain the signifi cance of the observation that peptides such as fMet-Leu-Phe “activate” the phagocytotic (particle-engulfi ng) functions of mammalian leukocytes (white blood cells).