Insulin is produced using O Aspergillus OGolden rice O Corn O Safflower

Q: Compare 2D polyacrylamide gel electrophoresis to LC-MS as a proteomics technique to identify…

A: Polyacrylamide gel is a technique used in organic chemistry, forensic chemistry, genetics, cell…

Q: Calcitonin is enzyme that functions to reduce blood calcium levels

A: Calcium may be a mineral that's found in a very form of foods. calcium is needed by the body to take…

Q: This type of fertilization happens when the sperm is introduced inside the female body through…

A: The process of fusion of sperm with egg (ovum) to produce zygote is called fertilization.

Q: Based on the fish dissection, describe the structure of skull and vertebral column design. How does…

A: Answer

Q: How does RhoGAM prevent HDN? A) it is an antigen that binds to and inactivates anti-Rh antibody from…

A: Introduction Antibody:- It is a protein made by plasma cells (a type of white blood cell) in…

Q: Imagine that a cell contains a temperature-sensitive mutation such that nuclear lamins cannot be…

A: Mitosis is a process where a single cell divides into two identical daughter cells (cell division).

Q: explain the concepts of inflammation

A:

Q: The process of respiration can be divided in several steps. Which of the following is the first one?…

A: Respiration is a process by which gas exchange take place between air and organism's cells. The…

Q: To describe: The ecological niche of humans.

A: The intended function that an organism performs within an environment is its niche. The biotic…

Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…

A: Social parasitism is interspecific parasitism.In this,two co species live in the same area and one…

Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…

A: Introduction Proteins are complex biomolecules and macromolecules that are made up of one or more…

Q: Answer in 3-5 sentences. What is the difference between thermoregulation in endothermic animals and…

A: Thermoregulation is process by which mammals maintain body temperature with tightly controlled…

Q: 2. Why do we use samples in the collection of data?

A: Introduction Scientific data:- It is defined as information collected using particular methods for a…

Q: XBT is a gene that controls the development of the body, specifically by determining the number c…

A: Answer: Toolkit gene  These genes regulate the embryonic developments. They are involved in central…

Q: osteopathy and chiropractic

A: Osteopathy: The treatment of medical disorders by manipulating and massaging the skeleton and…

Q: Calcitonin is enzyme that functions to reduce blood calcium levels True O False CK may be derived…

A: Storage lipids, also known as triacylglycerols, membrane lipids, which include glycerophospholipids…

Q: How many moles of EDTA (C10H16N2O3) do you have in 785µl of a 74MM EDTA solution (Mr(C10H16N203) =…

A:

Q: On average, about how many bird species were present in this forest plot before fragmentation? How…

A:

Q: The hydrolysis of ATP requires a. energy. b. water. C. a high temperature. d. energy and water. e.…

A: Answer is.. Water (b)

Q: Instruction: Using the data on the situation below, compute for the Hardy-Weinberg equation to…

A: Here the orange goldfish crackers are dominant & the white goldfish crackers are recessive. The…

Q: Briefly describe another technique you can use to study the interaction of Vitamin D3 with lipid…

A: Vitamin D3 with lipid membrane interaction.. Vitamin d3 is very important for our body as it…

Q: 1. Plants are classified into three types based on water availability in its habitat. What are these…

A: The plant body is complex, made up of several systems. Each system in the body has a distinct…

Q: 1. ____ are phospholipid with serine at coe that forms rafts that float about within the membrane.…

A: A phospholipid is a lipid with a phosphate group that is found in large amounts in cell membranes.…

Q: To relate: "The evolution of natural selection and the evolution of features that reduces the…

A: Natural selection is defined as the physical and reproductive fitness of a species in changing…

Q: Can these two concepts apply to the relationship between polar bears and humans & if so, how ? : 1)…

A: There are different  kind of interactions occurs in diverse organisms in the environment;which affet…

Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…

A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating.       “…

Q: The elderly tend to have difficultly absorbing vitamin A with age. O a) True b) False

A: Vitamins are the organic compounds which are required by our body in small amounts for maintaining…

Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…

A: As stem cells are the cells which have the ability to divide and can give rise to many different…

Q: This question follows from the last question The D value for a resistant strain of bacterial spores…

A: Time required to ensure a SAL of 10^6.

Q: Head Air sac comection with humerus bone Bronchus Humenus bone Heart 7 8.

A: Lungs are essential parts of the respiratory system. A pair of lungs are formed in such a manner…

Q: To brachiate is to O move around suspended from branches like a Siamang to leap from tree to tree…

A: Evolution can be defined as the unrolling of nature that brings about an orderly change from one…

Q: First food chain Second food chain Trophic level Organism Trophic level Organism

A: First food chain Trophic level organism Level 1 (Producer) Diatoms and other phytoplankton.…

Q: Fermentation is a strategy used by cells to a. oxidize NADH. b. reduce рyruvate. increase 02 levels.…

A: Introduction :- Fermentation is a metabolic process that uses enzymes to cause chemical changes in…

Q: In vertebrates, there exist a double circulation. What are these and explain each in the terms of…

A: Introduction The circulatory system pumps blood from the heart to the lungs to get oxygen, An…

Q: Not all Americans are willing to get the covid-19 vaccine, and not all countries have enough…

A: Vaccination : A biological preparation that can be used to activate the immune response in the body…

Q: 10. Which of the following is a water-soluble hormone? A. Testosterone B. Epinephrine C. Estrogen D.…

A: Thyroid hormone and steroid hormone are both lipid soluble hormones. All other hormones generated…

Q: Aside from cleanliness and access to clean water, propose scientific ways in controlling parasitic…

A: Parasitic diseases These are diseases that are caused by a parasite. These are infectious diseases…

Q: For billions of years, the only bright objects in the night sky were stars or the moon. Night-flying…

A: Moths are nocturnal organisms. They are active during the night to escape from predators. They use…

Q: For the number 7.31000 Convert the number to Scientific Notation. If you add1 to the last position…

A: Given number is 7.31000 To do= add 1 in the last position and convert it into scientific notation.

Q: The sodium pump is an example of a catabolic process. an anabolic process. stored energy. a. b. C.…

A: The sodium-potassium pump is an example of an active transport membrane protein/transmembrane…

Q: Give two examples of how forest fragmentation affects animals. How does island biogeography theory…

A: Forest fragmentation is the process by which forests are broken up into smaller and more isolated…

Q: Helen is a 62 yo smoker. Her physician has dignified her as having emphysema that has caused her to…

A: Given: Blood pH=7.40 To explain: To explain about pH level of a person and its effects

Q: What are the functions of ovaries in a flowering plant?? A. TO PRODUCE FEMALE GAMETES B. TO PRODUCE…

A: ovary, in flowering plants is enlarged basal portion of the pistil, the female organ of a flower.

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A:

Q: Question 5 Describe briefly the TWO distinct roles of the v-SNARE and t-SNARE proteins in vesicle…

A: Role of SNARE proteins in vesicle transport :-

Q: The most likely site for food contamination is: a) a person's own kitchen O b) the grocery store c)…

A: Introduction Food contamination:- It refers to food that has been corrupted with another substance –…

Q: ONE OF THE ANSWER IS WRONG PLEASE HELP ME FIND THE RIGHT ANSWER Duplication of genes is an…

A: Dominant alleles are always expressed whether present in homozygous or heterozygous forms. Where as…

Q: What are the characteristics common to all arthropods? List all of them.

A: Invertebrates are the organism belonging to animal kingdom which do not possess backbone . Such…

Q: Once pioneer transcription factors bind and attract chromatin remodelers, what do these chromatin…

A: The pioneer transcription factors are activators, they can associate with condensed chromatin. It…

Q: Describe the four membranes in the avian egg. How does EACH membrane affect the developing embryo?

A: Avian egg development.