In the TCA cycle, carbon enters the cycle as metabolic energy captured as a. and malonate, water, AMP, NAD+ and NADH b. acetyl-CoA; CO2; NADH; ATP; NADPH C. acetyl-CoA, C02, ATP, NADH and FADH2 with and exits as Choose the best answer! d. malonyl-CoA; water; NADH; [FADH2]; ATP
Q: Compare and contrast mitosis and meiosis by filling up the table below
A: Cell division involves mitosis and meiosis, which are two distinct processes. Despite sharing some…
Q: The authors in the abstract given above describe the mechanism for the activation of metallothionein…
A: Many heavy metals are toxic to humans. Certain proteins (like metallothionein) have the ability to…
Q: Please write out the answer.
A: 1) The pathway diagram shows that for the conversion of valine to glucose via gluconeogenesis, 2…
Q: Which of the following statements accurately describes differences in beta oxidation vs fatty acid…
A: The objective of the question is to identify the accurate statements that describe the differences…
Q: MSA: 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain the…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: Which statements describe electron transport chain events? > NADH releases two hydrogen ions and…
A: The electron transport chain is a system of four protein complexes that oxidise NADH/FADH2 and…
Q: The kinetic data in the following table were obtained for the reaction of carbon dioxide and water…
A: The substrate affinity of CO2 for carbonic anhydrase or Km is found to be 10 mM.Explanation:Step 1:…
Q: (c) The tube and cylinder diagram to the right illus- trates schematically the potassium channel…
A: answers are given below.Explanation:c) the positioning of Tyr62 and Thr74 on the Alpha helix is…
Q: Which is true of the following compound? It probably came from the hydrolysis of an oil The complete…
A: The compound considered has a structure shown below:It is a long chain carboxylic acid with three…
Q: Match each protein in the left column with its shape in the right column. Match the words in the…
A: Proteins are high molecular weight polymers that have diverse structural and functional roles within…
Q: Import of fatty acids is used for which of the following? (check all that apply) Production of…
A: The import of fatty acids into a cell can be used for several purposes. Step 1. Production of…
Q: Choose the statement that best explains WHY the aldol condensation is considered base-catalyzed. a…
A: Step 1: Step 2: Step 3: Step 4:
Q: The student advises using the same selection procedures and inoculating a 5 mL overnight culture…
A: Quantification: The process of plating on agar plates enables the counting of individual colonies,…
Q: Which of the following could act as one of the substrates in a reaction catalyzed by a…
A: Let's break it down in detail:Glycosyltransferases are enzymes responsible for catalyzing the…
Q: In addition to euchromatin and general transcription factors, initiation of transcription in humans…
A: The answer is 5-methylcytosine; proximal promoter but not distal promoterExplanation:Transcription…
Q: The activity of ________ will result in an increasedpositive charge on the histone.…
A: Answer: b. Histone deacetylaseExplanation:• Histone acetyltransferases (HATs): These enzymes add an…
Q: Please show your work and write it out
A: To answer these questions comprehensively, let's break down the process of glucose production in a…
Q: Calculate the equilibrium membrane potentials to be expected across a membrane at 37 ∘C, with a NaCl…
A: The objective of this question is to calculate the equilibrium membrane potential across a membrane…
Q: What percentage of max is obtained when the substrate is present at 80% of the Km? Use two digits in…
A: is the maximum velocity attained by an enzyme during a reaction. is the substrate concentration at…
Q: In the situations described below, what is the free energy change if 1 mole of Na+ is transported…
A: The objective of the question is to calculate the free energy change (ΔG) when 1 mole of Na+ is…
Q: Which of the following disaccharide repeats is the most stable towards hydrolysis? A.…
A: Stability of disaccharide repeats (or any polysaccharide) towards hydrolysis depends primarily on…
Q: The effects of hydroxymethylaspartate as an inhibitor for this enzyme was studied. The following…
A: The Lineweaver-Burk plot, also known as a double reciprocal plot, is a graphical representation of…
Q: A compound has a pKa of 7.4. You have made up 100 mL of a 1.0 M solution of this compound at pH 8.0.…
A: To find the ratio of the unprotonated to protonated form of the molecules, we'll use the…
Q: When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to acetaldehyde, then…
A: Step 1: When grown anaerobically on glucose, yeast (S. cerevisiae) converts pyruvate to…
Q: The following data is for the oxidation of catechol (the substrate) to o-quinone by the enzyme…
A: Phenoloxidase is a key enzyme in melanization that catalyzes the oxidation of phenols.…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: Many studies have linked plasmids to bacterial resistance to antibiotics. Closured circular…
A: Focusing on plasmids as a target to combat antibiotic resistance holds promise but requires a…
Q: For the following results of Thermodynamics of Borax Solubility, the volume of Borax solution…
A: Temp oCTemp KVolume Borax, mLVolume HCl, mLTotal Volume,…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options…
Q: The most important contribution to the stability of a protein's conformation appears to be the: ○ A)…
A: The most important contribution to the stability of a protein's conformation appears to be the:…
Q: 1. Hemoglobin F (HbF), known as fetal hemoglobin, is the predominant hemoglobin in the human fetus…
A: Hemoglobin is a protein found in RBC whose main function is to carry oxygen from the lungs to…
Q: 2. What is the major organic product obtained from the following reaction? CH3 Brz FeBr3 CH₂Br CH3…
A: Step 1:
Q: C Select the product of the following aldol condensation reaction. a A b B C [] d D e E A H H H B H…
A: Ans: D,EExplanation:Solution:The reactant molecule has two carbonyl groups and the conditions for…
Q: [AktivGrid] Draw the product of the reaction of isocitrate catalyzed by isocitrate dehydrogenase in…
A: Isocitrate dehydrogenase catalyzes the irreversible decarboxylation of isocitrate to yield…
Q: Which of the following hydrogens is most acidic? a A b B с C 11 1 CH₂ A с
A: Answer: b. BExplanation:On removal of the B proton, a carbanion(conjugate base) will form. Higher…
Q: With the advent of photosynthesis, the amount of oxygen in the atmosphere has varied over the eons…
A: Approach to solving the question:Detailed explanation:Examples:ANSWER IS 12 ML H20 Key references:…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: The oxyanion hole of a serine protease has which of the following roles (select all correct…
A: The objective of the question is to identify the roles of the oxyanion hole in a serine protease.…
Q: 3. In your textbook the termi- nal enzyme catalyzing the ter- minal step of glycolysis is known as…
A: Approach to solving the question: This question is divided into two parts:(a) The first part…
Q: What is the major organic product obtained from the following reaction? NaOH, H,O Δ ཨི ཁ (O) 2 ས ()…
A: Approach to solving the question: Detailed explanation: Examples: Key references:
Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…
A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…
Q: 2. Lactate dehydrogenase (LDH) catalyzes the reaction Ο ()) 0 NADH + H* NAD+ C=0 HO-C-H CH₁t…
A: Lactate dehydrogenase catalyzes the interconversion of pyruvate and lactate with concomitant…
Q: Only 100% sure experts solve it
A: Approach to solving the question: Detailed explanation: Examples: Key references:Computer Science -…
Q: If the anticodon of an alanyl-tRNA is IGC (inosine-guanine-cytosine), to which of the following…
A: In order to answer this question, we must be familiar with Wobble hypothesis. We know that the mRNA…
Q: 1. Draw the structure of an omega-3 fatty acid, docosahexaenoic acid (DHA, 22:6 (4,7, 10, 13, 16,…
A: The structural formula of DHA can be represented as follows:CH3 - CH2 - CH = CH - CH2 - CH = CH -…
Q: Under low tryptophanyl-tRNA (tRNAtrp), we expect the trp operon to be expressed because: Question…
A: Trp operon functioning in the bacterial system Escherichia coli consists of a set of genes that…
Q: A fluorescence recovery after photobleaching (FRAP) was performed at 37 °C. If the experiment were…
A: The objective of the question is to understand the effect of temperature on the rate of fluorescence…
Q: With the ninhydrin method, it was determined that an acyclic decapeptide consists of the following…
A: Elastase cleaves the peptide bonds formed by small hydrophobic amino acids, towards the C-terminal…
Q: Identify the product of the given reaction. IV I II III heat ? = III IV
A: Option (d) III is correct See solution in image Explanation:
Q: Hemp oil contains eicosenoic acid (20:149) as its primary monounsaturated fatty acid. Let's consider…
A: Approach to solving the question: Detailed explanation:1.β-Oxidation Products and ATP Required for…
Step by step
Solved in 2 steps
- Which of the following statements is true about CoQ? It is derived from carbohydrates. It carries electrons to Cyt. C It is a common electron carrier for both NADH and FADH2 ETC. It is position fixed in the electron transport chainThe Krebs cycle converts ________ through a cycle ofreactions. In the process, ATP, ________, and ________ areproduced.a. acetyl CoA; FAD, NADb. acetyl CoA; FADH2; NADHc. pyruvate; NAD; FADH2d. pyruvate; oxygen; oxaloacetateComplex I and Complex II produce a common product which is: O reduced cyt. c. O FAD. O NAD+. reduced coenzyme Q. reduced 02
- 1. The final electron acceptor during electron transport is produces the most ATP 3. Acetyl CoA is involved in the 2. 4. NADH and FADH2 transfer their electrons to 5. The flow of electrons leads to the build up of 6. Glycolysis occurs in the 7. Krebs cycle occurs in the 8. IF oxygen is not present, the electron transport chain will still proceed . True or False?? 9. Both lactic acid and alcoholic fermentation produce_ 10. Carbon dioxide is produced during andCreate a visual representation, or a diagram, of the concepts in respiration and photosynthesis. You are NOT simply creating a list of terms with definitions, but a diagram of the process. Use ALL of these terms in the diagram/representation. Acetyl CoA --- Aerobic --- Anaerobic --- Citrate --- Citric Acid Cycle --- CO2, H2O, O2, ATP, ADP, Pi, NADH, NAD+, FADH2, FAD, GTP, and GDP --- Coenzyme --- Cytoplasm --- Electron Transport Chain --- Ethanol --- Fermentation --- Glucose --- Glycolysis --- Inner Mitochondrial Membrane --- Lactic Acid --- Mitochondrial Matrix --- Oxaloacetate --- Pyruvate --- Pyruvate OxidationHow are anaerobic respiration and fermentation similar? In both cases, O A. oxidation of glucose provides the cell with ATP В. oxidation of NADH provides the cell with ATP reduction of glucose provides the cell with lactate OPreduction of NADH provides the cell with lactate
- Looking at the image shown here, which of the following statements DOES NOT correctly identifies the location of metabolites related to photosynthesis and/or respiration in the diagram of Chlamydomonas? F G H O A. Fermentation occurs in D. B. Glyceraldehyde-3-phosphate (G3P) is generated in C. O C. ATP can be found in D. D. Pyruvate is generated in G. O O OIn general, the mechanem of phosphorylation s most smlar A Substrate level phosphorylation B Oxidative phosphorylation C. Calvin cycle D. Citric acid cycle E. Reduction of NADIn the malate aspartate shuttle, electrons from are transferred to_forming malate. mitochondrial NADH; alpha ketogluterate cytoplasmic NADH; alpha ketogluterate cytoplasmic NADH; oxaloacetate mitochondrial NADH; oxaloacetate mitochondrial NADH; aspartic acid cytoplasmic NADH; aspartic acid
- The electrons generated from the Krebs (TCA) cycle are transferred to Glucose O Oxygen O NAD+ and FAD+ O Acetyl CoAThe TCA cycle produces Multiple Choice ATP, FAD, and precursor metabolites NADH, ATP, and FAD. FADH2, NADH, and precursor metabolites. FADH2, ADP, and NADH. precursor metabolites, NAD, and FADH2.Which of the following statements about the use the NADPH generated from the pentose phosphate pathway is not true? NADPH generated from the pentose phosphate pathway is used for the synthesis of fatty acids. b. NADPH generated from the pentose phosphate pathway and cytoplasmic NADH is metabolically interchangeable. O c. NADPH generated from the pentose phosphate pathway is used for the regeneration of glutathione to its reduced state. O d. NADPH generated from the pentose phosphate pathway is used for lipid synthesis. Clear my choice