In the genome of Zea mays, in the segment 120M to 120,030k of Chromosome 5, what repeat elements do you find using Repeat Masker? 18 simple repeats, 5 LTR elements O 21 simple repeats O 24 LTR elements 19 LTR elements, 3 simple repeats

Q: What is the specific molecule recognized in our ELISA to measure phospholipase C activity? How is it…

A: Snadwisch ELISA method can be to measure phospholipase c activity can detect the level of PLCG2…

Q: what part is pointed in letter D?

A: Introduction A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…

Q: 6. Which of the following statements best explains why cancer is so difficult to cure? O A. Each…

A: Cancer is a condition in which some cells in the body grow out of control and spread to other parts…

Q: To determine: The trophic levels and the way in which they are related to ecological pyramids.

A: The Sun provides energy to the Earth in the form of light. The organisms efficiently exploit the…

Q: how should we prepare for the next pandemic? What  project that can be implemented to avoid future…

A: Introduction Pandemic:- A pandemic is the worldwide spread of a new disease, It is a disease…

Q: 7. The average length of the double helix in human chromosome is 3.8cm. i. Approximately how many…

A: Dna is the polymers of nucleotides . Two consecutive nucleotides in the dna are separated by the…

Q: Which of the following objects would you use microinjection in order to transfer DNA into? a. Egg…

A: Microinjection is the process of transferring DNA materials into a living cell. It can be done by…

Q: The development of DNA technology is bringing profound changes to science, agriculture and…

A: Introduction DNA technology is an extremely important research tool in biology as it allows the…

Q: C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' i. What would be the first 5 bases at the 3' end of the…

A: 3' C-A-G-T-T-A-A-G-G-C-T-C-C-T-A-G-G-T-T-A 5' Complementary strand- 5'- CTCAATTCCGAGGATCCAAT-3'   i)…

Q: bacteria

A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…

Q: To explain: The way in which predator-prey relationship is affected by natural selection.

A: Charles Darwin was an English naturalist who was interested in outdoor activities from a young age.…

Q: Question How does the female reproductive system protect itself from pathogens?

A: Pathogen  It is defined as the organism that have the ability to cause a disease. The microbes cause…

Q: Briefly describe another technique you can use to study the interaction of Vitamin D3 with lipid…

A: Vitamin D3 with lipid membrane interaction.. Vitamin d3 is very important for our body as it…

Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…

A: DNA  contains the genetic information about the characteristics features of te organism present in…

Q: What about Phloem?

A: Plants, of course, do not absorb food in the same manner that humans do. Rather, while…

Q: Is an increase in albumin excretion observed only in pathological urine? Why or why not?

A:

Q: from stimulus to effector muscle

A: We know that nervous system will coordinate and control the activities of animals and humans .…

Q: One objection many people have about vaccinations is the amount and variety of chemicals in them.…

A: Vaccination is a simple, safe and effective way of protecting you against harmful diseases. It uses…

Q: .  How does temperature affects the BFC and WFC? And how can it be a potential cure for obesity?  2.…

A: Brown fat increases metabolism upon body exposed to cold temperatures.Brown fat breaks down to…

Q: escribe the behavior and neural mechanisms involved luring cricket communication used for…

A: Crickets are nocturnal, so they chirp at night. Male chirp to attract the female for mating.       “…

Q: How many amino acids would there be in the protein produced from the following mRNA molecule ?…

A: 1. Stop codons- UAA, UAG and UGA. Codon consists of 3 nucleotides. There are 11 codons, but  10…

Q: While you were driving to San Francisco, you saw many billboards on the highway but you could not…

A: The smallest level of stimulation that may be recognised is known as an absolute threshold, which is…

Q: Define the term “carbon neutral,” and describe how biomass-based sources have the potential to be…

A: The earth is inhabitable because of the presence of water bodies and oxygen. The atmosphere of earth…

Q: Petunias normally have purple flowers. Suppose you identify a recessive mutant that has white…

A: Petunia have purple flower in wild type phenotype. Whereas the white flower are present due to…

Q: The epidemic that infected Europe, North Africa, and theMiddle East and killed tens of millions of…

A: Introduction An epidemic is a sudden increase in the number of instances of a disease beyond what…

Q: The elderly tend to have difficultly absorbing vitamin A with age. O a) True b) False

A: Vitamins are the organic compounds which are required by our body in small amounts for maintaining…

Q: Question - Summarize the goals of conservation biology .

A: In Conservation biology the  bio-diversity of earth and nature is conserved. It is a…

Q: Explain auxin’s effect on growth and how it causes plant cellsto enlarge.

A: Plants naturally produce auxins, a potent growth hormone. They promote cell division, stem and root…

Q: DNA DNA Leading strand mRNA tRNA Amino Acid A T G         A A A         G T C         A T…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: Which of the following does NOT play a role in DNA replication? O helicase promoter O ligase…

A: ANSWER;- None of the above Explain;- Does not play a role in DNA replication is a stop codon. -Stop…

Q: Male spotted bugs often allow the female to eat them during mating. You are a scientist studying…

A: From the graph it can be concluded that the average number of eggs are much more when males are…

Q: Consider the similarities and differences in the cell cycles (mitosis and meiosis) of plants and…

A: Mitosis and Meiosis similarity  1. Both occur during cell reproduction.  2. Both occur in stages.…

Q: Question - Summarize the goals of conservation biology .

A: Conservation biology- It is an applied science based on ecological principles. it focuses on…

Q: To explain: The typical pyramids of numbers, biomass, and energy.

A: The sun provides energy to the Earth and actually defines that they're supposed to form through and…

Q: All of the following have contributed to the obesity epidemic in young teens EXCEPT: a) increased…

A: Obesity is a national problem that contributes to some of the country's leading causes of mortality,…

Q: A population has 700 individuals, 85 of genotype AA, 320 of genotype Aa and 295 of genotype aa. What…

A: The Hardy-Weinberg equation is expressed as: p2 + 2pq + q2 = 1  p is the frequency of the "A" allele…

Q: How could you distinguish among carbohydrates,lipids, proteins, and nucleic acids?

A: A macromolecule, including a protein or nucleic acid, is indeed a very big molecule crucial to…

Q: 10. Phagocytosis by a phagocyte is required for: B cell action b. helper T (T4) cell action c.…

A: Answer

Q: Supported lipid bilayers (SLBs) are widely used in biophysical research to investigate the effect of…

A: Supported lipid bilayer or SLB is the artificial platform based on solid surface, that can mimic the…

Q: Is this type of ETi sweets harmful? Wale "up wafer with COCoa cream

A: Is the sweets like water with cocoa cream harmful?

Q: (Y=black/y-yellow). The heterozygotes are the color mixture called calico or tortoise-shell. What…

A: The coat color is encoded by the genes present on the X chromosomes.  The black color is present in…

Q: All of the following are benefits of breast feeding EX a) The baby will receive complex…

A: In infants below 6 months of age, it's advised that breastfeeding is to be followed. Breastfeeding…

Q: a catabolic process.

A:

Q: Can you pls go into more detail regarding the growth regulators and how it works.

A: Plant Growth regulator(also known as plant hormones) are a group of chemical compounds that have a…

Q: chromosomes will there be in the cells at the When, during the life of an organism, would you expect…

A:

Q: Match the following scientists who emerged in specializedfields of microbiology to their famous…

A: Introduction :- Virology is the study of viruses and virus-like entities, which are submicroscopic…

Q: Hello, Please answer the following attached Microbiology question AND ANSWER ALL 3 PARTS COMPLETELY.…

A: There are several staining methods are already discovered and continuously used in microbiology one…

Q: Why does a red blood cell plasma membrane need transmembrane proteins?

A: Introduction:- RBCs require transmembrane protein to connect the cell's outside with its interior.

Q: You are a scientist studying the relationships between lizards, penguins, and parrots. You examine…

A: The trait no body temperature regulation is found in al common ancestors and hence will be a…

Q: 9. Coronary arteries route oxygen leH of the: d. descending aorta halpern round-a-bout a.…

A: Coronary artery supplies the fresh blood to the heart wall. It is of following types-Left anterior…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.