In the diagram below, white represents maternal information and black represents paternal information. This stage is O O O Mitosis Meiosis 1 Meiosis 2 A D O A d C D A d

Q: Which of the processes does not lead to variation in offspring with the same parents?*       A.…

A: variation means any difference between cells or individual organisms of any species caused either by…

Q: NAD+ sources sources for your cells are: FAD+, FMN, glycolysis glycolysis, the Krebs cycle, the…

A: NAD+  Necotinamide adenine dinucleotide is a co-enzyme that take part in many metabolic reactions of…

Q: As a global citizen, how can you save the life below water?

A: Recently, WHO has proposed the "One Health approach" which says, the well-being of the complete…

Q: What are the 5 spaces of the infrahyoid neck and the contents of each?

A: Introduction :- The visceral, anterior, posterior, carotid, retropharyngeal, and perivertebral…

Q: How does the size of the human popula Contribute to environmental degradation? ton

A: In 1800, the Earth's population was around 1 billion, while only 2 centuries later, the global…

Q: is involved in anterograde transport of proteins from the ER to Golgi. Ocaveolin clathrin COP II…

A: The vesicle transportation across cell is mediated by the microtubules present in the cell. The…

Q: Inquiry and Analysis Do Enzymes Physically Attach to Their Substrates? When scientists first began…

A: Enzyme are usually protein molecules that are highly specific to their substrate. These are…

Q: Homologous chromosomes migrate to opposite poles during: O Anaphase II of meiosis O none of the…

A: Introduction :- Chromosomes are formed during prophase I during the condensing of the DNA and…

Q: Create a mind-map about the concepts you know, or understand about Dental Public Health.

A: Introduction   Individuals can benefit from dental care. A good root canal or filling can…

Q: Explain the physiological basis for why sensitive skin areas have smaller two-point threshold…

A: Two point threshold :- It is the  smallest distance between the pressure points on skin  which can…

Q: During which phase of the growth curve are bacteria most susceptible to antibiotics? Why?

A: Introduction :  Antibiotics are medications used to eradicate or stop the development of pathogenic…

Q: The following describes the decrease concentration of particles in water: O a Hypertonic Fluid Ob.…

A: Introduction :  Osmosis is defined as the movement of solvent molecules through a selectively…

Q: In Hydrozoans such as the Obelia pictured above, what do gastrozooids and gonozooids have in common,…

A: Hydrozoa are taxonomic class of tiny, predatory creatures, a few lone and some colonial, the vast…

Q: The following is the major extracellular electrolyte diffusing from the ECF into the ICF across a…

A: ECF is extracellular fluid present outside the cellular environment.  ICF is intracellular fluid…

Q: Describe the difference between the distal end of a humerus and the distal end of a femur

A: The femur is the body’s largest & longest bone. It is also called as a thighbone. This bone is…

Q: Question: Identify one The two distinguishing features of the group known as catarrhines are…

A: Lemurs from Madagascar, lorises from Africa's Continent, and galagos from tropical Asia make up the…

Q: Which of the following statements is false regarding phagocytosis? It can ingest large particles. It…

A: Introduction   Phagocytosis is the mechanism by which a cell uses its plasma membrane to engulf a…

Q: Given the following, the sequence of urine flow in the urinary tract is: i. Renal papilla ii. Major…

A: Urine  The typically yellowish colour wates fluid filtered by the kidney and stored in urinary…

Q: F ST A E B C

A: A) Hypothalamus  B)Supraoptic nucleus  C)Para ventricular  nuclei D)Superior  hypophyseal artery

Q: ce-SCS x 19.core.learn.edgenuity.com/player/ Science-SC5181 A ↑ O All biomes will show decreases in…

A: A biome is an area classified according to the species that live in that location. Temperature…

Q: The following are the hydrophilic regions of a selectively permeable cell membrane: O a Water Loving…

A: The cell is the smallest structural and, functional unit of life. It is simple machinery that houses…

Q: Question 9 the picture shows a student using a microscope to study a prepared slide of single-celled…

A: The correct option is: A. Nucleus

Q: 4b. Describe how the Bohr effect helps to transport CO2 from tissues to the lungs and to remove CO2…

A: Introduction  Christian Bohr, a well-known scientist, was the one who initially studied the Bohr…

Q: Referring to the degeneracy of the genetic code, explain why alterations to the first base of a…

A: We know there are four nitrogenous bases in a DNA or RNA like adenine(A), Thymine(T) in case of…

Q: 2. Which is least like the human and, therefore, the most specialized ?

A: The animals given in the list are different animals. They all possess different characteristics and…

Q: Describe the historical pattern of growth the worldwide human population Since our OF origin

A: Population refers to the number of individuals living in a particular area. Any increase in the size…

Q: Identify the following bones of the Face that are shaded with different colors: Ethmoid Lacrimal…

A: Introduction  Bones are composed of specialised bone cells and connective tissue that has been…

Q: Experiment: In this activity yo Page 5 ze the results of experiments that investigate nutritional…

A: The media is minimal when it lacks one or more nutrient composition, which a particular strain is…

Q: Which of the following is the role of axonal Calcium (Ca2+) channels in neuronal communication at…

A: Correct option of the question is "E". Synapse are form between presynaptic terminal of a neuron and…

Q: Could the mini-prep protocol purify RNA? Why or Why not? Based in your answer, what is the…

A: RNA Miniprep protocol is the  RNA isolation protocol which is available and designed for easy,…

Q: Explain the neutralist versus selectionist debate. What patterns are expected from each? What data…

A: Explanation: The argument between neutralists and selectionists refers to the controversy among…

Q: An injection of epinephrine was administered to a patient. On administering, the heart rate & blood…

A: Epinephrine It is also known as adrenaline which is a hormone and neurotransmitter involved in the…

Q: D In the following DNA strand, find the position of the start codon, stop codon and determine the…

A: The given DNA strand - GGTACTTTATACCCTGATACATTTGTGGGG Corresponding mRNA strand -…

Q: why would a cell invest ATP to move particles using active transport?

A: Materials must be moved against a concentration or electrochemical gradient, which requires the cell…

Q: 1. The axons of olfactory receptor cells constitute CNI

A: Introduction :- In your brain, each neuron has a single, lengthy cable that extends from the cell's…

Q: . Could u pls discussed about the water pollutants and Summarize the details 2. discussed about air…

A: A chemical or energy put into the environment which has unintended consequences or negatively…

Q: Follicle-stimulating hormone stimulates the production of a. steroids in the adrenal cortex. b.…

A: Introduction :  Endocrine glands produce hormones, which are specific chemical messengers that are…

Q: . How sure would we be that he is not a carrier if all the calves are born normal? How many would…

A: Curly calf syndrome is a genetic disorder that is lethal for the calf. It is seen in beef cattle and…

Q: Use the concept of sensory adaptation to explain how sensory adaptation occurs for either the sense…

A: INTRODUCTION : Sensory adaptation - It is a reduction in sensitivity/reaction to a stimulus after…

Q: What do you understand by “Sequencing by synthesis?” What is FRED score? Give an example.

A: DNA sequencing help in understanding basic structure of DNA which is nucleotide. Sequencing help us…

Q: describe how the circulation (blood vessels) and the heart have integrated functions in providing…

A: Cardiovascular system consist of the blood vessels,its main types are Arteries,Veins and…

Q: ¹C2²2S + E Sk3,0 where S is a T-cell of a particular variety, E is the corresponding (free, i.e.…

A: T cell, also called T lymphocyte, type of leukocyte (white blood cell) that is an essential part of…

Q: Describe vesicle trafficking process.

A: The cells of our body are made up of many organelles and each one has its specific role to perform.…

Q: Discuss Equality in the Sexes in Human Evolution. What is it all about?

A: Evolution is the study where changes in populations and communities are observed over many…

Q: 8. You have sequenced a segment of DNA from a species in the genus Lithobates (true frogs). The…

A: Template strand is a sense strand. and the coding stand which actually does not  codes for m RNA is…

Q: In transcription, the termination signal is a DNA sequence that tells RNA polymerase to A stop…

A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are nucleic acids and serve as carriers of…

Q: 14. The hormone that is expected to be found in greater-than-normal amounts in a man who has been…

A: Luteinizing hormone is a hormone produced by gonadotropic cells in the anterior pituitary gland. The…

Q: Sequence the steps to transfect and observe a fluorescent protein in a slice of the brain:

A: Transfection is the process of artificially introducing nucleic acids (DNA or RNA) into cells,…

Q: 25. Name the transport processes or capillary structure used to move the following substances out of…

A: Membrane transport refers to the movement of particles (solute) across or through a membranous…

Q: Discuss the components of a motor unit. What is the difference between a motor unit and a motor…

A:

Oogenesis

The formation of the ovum (mature female gamete) from undifferentiated germ cells is called oogenesis. This process takes place in the ovaries (female gonads). Oogenesis consists of three stages known as the multiplication phase, growth phase, and maturation phase. 

Cell Division

Cell division involves the formation of new daughter cells from the parent cells. It is a part of the cell cycle that takes place in both prokaryotic and eukaryotic organisms. Cell division is required for three main reasons: