In and out M 3. What are restriction enzymes used for in nature? are used by backsta ta bock ria to cat yo Restriction enzymes are used the DNA. 4. Look at the Jellyfish Glo gene. The start (TAC) and stop (ACT) DNA sequences of the gene are marked by black boxes. What process are they the start and stop of? 5. Why did we make sure to include these start and stop DNA sequences for the Jellyfish Glo gene in our cut segment? 6. If we want to now produce a lot of this Jellyfish Glo protein, what do we have to do now with the transformed bacteria to get a lot of protein from them? procedure. 7. Identify the structure in each section of the diagram and explain what its role is in this whole
Q: Prophase I Metaphase I Anaphase I Telophase 1 + Cytokinesis Prophase II Metaphase II Anaphase II…
A: A zygote is a diploid cell formed by the fusion of two haploid gametes during fertilization. This is…
Q: Please answer the following question and explain Q1. If MacLeod and McCarty had accidentally…
A: DNA - All genetic information is carried by deoxyribonucleic acid, or DNA. It codes genetic…
Q: A biologist hypothesizes that habitat fragmentation and loss has led to a more clustered…
A: Biological statistical analysis is the application of statistics to analyze data in biology. It's a…
Q: How are amino acids grouped together? What properties do these groups have?
A: Amino acids are the building blocks of proteins, and they are classified into groups based on the…
Q: Type of Linkage (incompletely linked, completely linked or unlinked)
A: (1) Cross: AaBb x aabb Ratio:1AB: 1Ab: 1aB: 1ab Reasoning:- The equal distribution of allele…
Q: Which country has the highest per capita emission of carbon dioxide? United States Canada Saudi…
A: Per capita carbon dioxide (CO2) emissions are a basic measure utilized to understand the…
Q: The three Abrahamic religions (Judaism, Christianity, and Islam) are all correctly categorized as:…
A: The objective of the question is to correctly categorize the three Abrahamic religions (Judaism,…
Q: A small lake is capable of supporting both bluegill and smallmouth bass. These two bony fish species…
A: Carrying capacity: It can be defined as maximum ability of a specific area to withstand the maximum…
Q: In the podcast on how to read a scientific paper what did Prof Fraser and Prof Clare conclude about…
A: Prof. Fraser and Prof. Clare's podcast on how to read a scientific publication provides excellent…
Q: could you explain a bit more what this sentences mean: The information displayed demonstrates a…
A: Dentate gyrus is an important region in the hippocampal formation of the brain. This portion is…
Q: In the podcast about scientific literature, Prof Fraser and Prof Clare described the parts of a…
A: The objective of the question is to identify the correct description of the 'discussion' section of…
Q: A mutagen is an agent that increases the possibility of a mutation and a carcinogen is an…
A: Mutations can occur spontaneously or be induced by various factors, including mutagens. However, not…
Q: how do i expand this into 1000 words The methodology employed to identify differentially expressed…
A: Researchers use a multi-step process to pinpoint genes with altered expression in breast cancer…
Q: Which of these is true of white blood cells? There may be more than one correct answer. WBCs become…
A: The immune system of the body includes white blood cells (WBCs). They support the body's defenses…
Q: Match the challenges of protected area management to some of the potential solutions. Increase…
A: Protected area management includes an assortment of challenges that require vital solutions to…
Q: True or False? Excessive body water losses via sweating during exercise can lead to decreases in…
A: The objective of the question is to determine whether excessive body water losses via sweating…
Q: QUESTION 1 The relative amounts of each nucleotide base are tabulated below for four different…
A: Virus I:Single-stranded DNAVirus II:Single-stranded RNAVirus III:Double-stranded RNAVirus…
Q: (If you don't have colour, there Describe the process that is taking place in the diagram are brown…
A: The diagram likely depicts a process related to evolution, specifically natural…
Q: Part 1 Bio Question 5
A: The objective of the question is to identify the protein(s) that bring bound activators in contact…
Q: Which type of cytoskeletal element is characterized as a hollow, rigid cylindrical tube with walls…
A: The question is asking to identify the type of cytoskeletal element that is described as a hollow,…
Q: (please correct answer and correct and incorrect option explain) For autosomal dominant disease with…
A: Autosomal dominant diseases with inadequate penetrance present a challenge in clinical genetics. In…
Q: Apply what you have learned to this model of a terrestrial animal living in a dry environment. Which…
A: Terrestrial animals are those animals which primarily live on land. They perform all their metabolic…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options.
Q: mulation Activity ctivity, you will be provided with the DNA nucleotide ce that codes for a…
A: DNA is a double helical molecule that helps in the transcription of mRNA which is eventually…
Q: Explain the difference between broad-spectrum and narrow-spectrum antibiotics.Give at least two…
A: Antibiotics fight bacterial infections, but they differ in how targeted they are. Here's the…
Q: What are some of the strategies that can be considered integrated conservation development projects?…
A: Integrated conservation development project links not only the conservation of biodiversity in an…
Q: St. Aurelius Augustine, in his theodicy attempting to reconcile freedom and determinism, recognized…
A: The question is asking about the theological implications of St. Aurelius Augustine's theodicy,…
Q: Three recessive traits in garden pea plants are as follows: yellow pods are recessive to green pods,…
A: If the genes are located on the same chromosome then they are classified as linked genes. In this…
Q: Like all viruses, HIV must utilize the host: ○ a. reverse transcriptase. ○ b. ribosomes. О с.…
A: HIV (Human Immunodeficiency Virus) is a retrovirus that targets CD4+ T cells in particular,…
Q: blend of essential oils can be kept for up to how long
A: Oils lose their natural moisture-binding ability. Like most other nature-based products, essential…
Q: 18) Based on your knowledge of lactose system in prokaryotes) and considering the following…
A: Operon is the gene regulatory mechanism of prokaryotic organisms. In case of lactose operon the…
Q: Explain problems associated with the Demographic Trap in terms of changes in human population…
A: The Demographic Trap is a situation where a country's population growth rate is so high that the…
Q: The group of disorders associated with single gene mutations affecting amino acid sequences in the…
A: The question is asking about the name of the group of disorders that are caused by single gene…
Q: Match the chromosomal rearragement shown below (a-d) with the term for that particular chromosomal…
A: Chromosomal rearrangements are changes within the structure of chromosomes that can happen normally…
Q: Isoprene serves as a building block not only for the hydrocarbons observed in archaeal membranes but…
A: Isoprene is a five-carbon, branched molecule and its chemical name is 2-methyl-1,3-butadiene. The…
Q: Herophilus from Chalcedon identified how many chambers in the human heart? 6 chambers: the right…
A: The question is asking about the number of chambers in the human heart that were identified by…
Q: What is the null hypothesis for the above urine test for glucose? that glucose in the urine is a…
A: The objective of the question is to identify the correct null hypothesis for a urine test for…
Q: Describe the autoclave and explain the roles of time, temperature, and pressure in the functioning…
A: ● An autoclave is a sterilization device used widely in medical, laboratory, and industrial…
Q: #. What is the purpose of the respiratory system? Answer plz!
A: Respiratory system can be divided into two parts conducting part and respiratory part. Conducting…
Q: A(n) -------------------phase is almost always needed so that refinements to the intervention can be…
A: In the development of any intervention, especially within the fields of public health, psychology,…
Q: Switchgrass is used for ethanol production. The composition of the switchgrass is 37% cellulose, 24%…
A: Lignocellulosic Sugar Production:Glucose: 370 kgXylose: 240 kgGalactose: 30 kgArabinose: 40…
Q: ) If you counted 500 CFU’s in the 7th tube how many CFU’s you should expect in the 9th test tube?…
A: To answer these questions, we need to understand CFU (Colony Forming Units) and how they relate to…
Q: Question 1: In the land between the lakes, Elk and Bison Prairie, we currently have 125 bison and 15…
A: The objective of this question is to find the population size of elk at which the isocline of the…
Q: Under which condition would the release of neurotransmitter by bipolar cells attached to cones be…
A: Neurotransmitters are pivotal molecules that facilitate communication within the nervous system,…
Q: What drives the rotation of the F1 head (rotor) of ATP synthase? a. proton movement from…
A: The question is asking about the mechanism that drives the rotation of the F1 head, also known as…
Q: Explain
A: The question is asking to calculate the melting temperature (Tm) and the percentage of…
Q: How many fragments and how big each fragment should be after digesting the plasmid with BamHI? How…
A: Digestion of the pUC19 plasmid using the restriction enzymes BamHI and PvuI.1.BamHI Digestion:BamHI…
Q: Calculate the two possible values of x in this equation: x2 – 11x + 24 = 0, either by using the…
A: The objective of this question is to find the roots of the quadratic equation x^2 - 11x + 24 = 0.…
Q: In the Meselson-Stahl experiment, what happened after the E. coli was moved to the N14 medium and…
A: The objective of the question is to understand the results of the Meselson-Stahl experiment after…
Q: GQ6
A: The objective of the question is to determine the number of amino acids or codons that a gene will…
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5. a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3? c) How many bands of DNA are there in lane 5? d) There would be 2 bands of DNA in lane 4. How big are they? e) Which lane…ull rain LTE 11:53 © 1 0 A 10% Done #1 Mol Bio Restriction Analysi... Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the PMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol DNA size ladder 600 bp 500 bp 400 bp 300 bp 200 bp 100 bp VC 100bp Plus DNA ladder from Vivantis Technologies *The same total amount of DNA was loaded in each lane. 1. What is the total size of the PMBBS plasmid in bp? Answer: bp 2. How many cut sites on the…Part 3. Compare the Specificity of DNA-Cutting Tools The flexibility and specificity of CRISPR-Cas9 technology offer a large step forward for gene editing. The first DNA "scissors" were restriction enzymes, which cut DNA at predefined sequences, typically 4-8 base pairs long. For example, EcoRI, a restriction enzyme found in E. coli, will cut double- stranded DNA at every GAATTC sequence. If EcoRI were added to a sample that contained the entire human genome, it could cut at every GAATTC sequence. We can calculate the probability that a particular nucleotide sequence, such as GAATTC, will occur within a larger sequence. Table 1 below shows the calculated probabilities of finding sequences of particular lengths. These calculations are based on the assumption that DNA sequences are entirely random and that every nucleotide position has an equal probability of being A, T, C, or G. Use the table to answer the following questions. Table 1. Calculated probabilities of finding a specific…
- Section A: Linear DNA Common restriction enzymes include: EcoRI, Hindll and BamHl and their sequences are as follows, with the cut site indicated by the arrow (figure 1). Please note that A DNA refers to linear DNA in this tutorial. HindIII 5'..A AGCT.3' 3'....TTCGA A...5' EcoRI 5'..G AATTC...3 BamHI 5'....G GATCC...3' 3' .....CTTAA G..5 3'...CCTAG G...5' Figure 1: Restriction sites of restriction enzymes. When DNA is cut with restriction enzymes, the fragments can be seen on an agarose gel (see figure 2). Base Pairs 21220 25.000 10.000 8,000 6.000 5,000 6557 4361 1641 7233 4,000 3,000 2,500 7421 2.000 5804 E643 1,500 1.000 4878 750 -564 S00 E 3530 125 250 A cut with EcORI A cut with Hindil A cut with BamHI A C D Figure 2: DNA fragments on an agarose gel showing the following: A) a molecular ladder, B) DNA cut with EcoB, C) DNA cut with Hipd, D) DNA cut with Bam The above figure shows the size of each of the fragments/bands produced when A DNA is cut with each of these restriction…Part A Which of the following statements concerning restriction enzymes is true? Select all that apply. ►View Available Hint(s) ☐ Restriction enzymes specifically target and cut RNA in a sequence-specific manner. Restriction enzymes occur naturally in viruses as a defense mechanism against bacteria. Some restriction enzymes generate overhangs in the target DNA sequence upon incubation. During a cloning experiment, the vector and target DNA should be cut with different restriction enzymes to ensure that sticky ends are generated. SubmitPart 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
- Part 2. PCR 1) In one color, write out the forward primer (5’ GATAC 3’) in the correct position relative to the given template DNA sequence. In a second color, act as the polymerase and fill in the rest of the new strand of DNA Primer/New Strand Template DNA: 3’ TAGCTATGCGGACCTCATGCATTAGAGTAG 5’ Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and…Formation of a recombinant DNA molecule. 1 GAATTC GAATTO CITAAG CTTAAG double-stranded DNA CAATTO BAATTO CTTAA CITAAT (| AATTC GI AATTC CTTAA IG GHATIC СТТАА G In the above diagram, 1' represents the O sticky ends re striction sites primer O restriction fragmentsRestriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’
- Some Steps Involved in Creating Recombinant DNA 1. Plasmid DNA is cut at the restriction site.2. Foreign DNA is cut at the restriction site.3. Plasmid DNA is opened and sticky ends are formed.4. Foreign DNA restriction fragments are isolated5. Target sequence in the plasmid is recognized by the restriction endonuclease.6. Target sequences in the foreign DNA are recognized by the restriction endonuclease.7. Foreign DNA restriction fragment is inserted into the plasmid at the restriction site.8. DNA ligase splices the foreign restriction fragment and the plasmid together. Identify the correct sequence of steps involved in cutting and reassembling DNA molecules to make recombinant DNA. Start with preparation of the plasmid DNA. Select one: a. 6, 2, 4, 7, 8, 5, 1, 3 b. 5, 1, 3, 6, 2, 4, 8, 7 c. 5, 1, 3, 6, 2, 4, 7, 8 d. 6, 2, 4, 5, 1, 3, 8, 72. Restriction Enzyme Mapping - use any resources to assist you including the hints below. A circular plasmid molecule (12,000 total base pairs in size) was cut with a series of restriction enzymes and the digestions were size fractionated by agarose gel electrophoresis. Some digestions involved just one enzyme (single digest), some combinations of two enzymes (double digests), and one utilized all three enzymes (triple digest). Agarose gel electrophoresis of the digestions produced bands of the following sizes. Enzyme EcoRI Hindi!! Pstl EcoRI and Hindill EcoRI and Psti Hindill and Pstl EcoRI, Hindill, and Pst I Bands of the Agarose Gel (size in base pairs) 2300 and 9700 4000 and 8000 12,000 800, 1500, 2500, and 7200 2300, 3200, and 6500 4000 800, 1500, 2500, 3200, and 4000 I Draw a plasmid map showing the location of the restriction enzyme sites relative to each other for each map. Include all 7 maps in your answer.25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.