Answered: if one strand of the DNA molecule has…

Name: 22..2 if one strand of the DNA molecule has the sequence 5’ TACGA 3, T
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 22..2 if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the sequence:3’ UACGCA5’3’AUGCGU 5’ 3’ ATGCGT 5’ 3 TACGCA 5’3’ ATGCGT 5’

Science

Biology

if one strand of the DNA molecule has the sequence 5’ TACGA 3, The other strand would have the sequence: 3’ UACGCA5’ 3’AUGCGU 5’ 3’ ATGCGT 5’ 3 TACGCA 5’ 3’ ATGCGT 5’

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 5TYU: If a segment of DNA is 5 CATTAC 3, the complementary DNA strand is (a) 3 CATTAC 5 (b) 3 GTAATG ...

See similar textbooks

Similar questions

1. Predict the following sequences of base in the DNA strands complementary to the single DNA strand: • 3'A-G-T-C-G-T-A-C-A-T-G 5 • 5'G-T-C-G-T-A-C-T-A-G-C 3' • 5'C-A-T-G-C-T-A-G-C-T-A 3' • 3'A-T-C-A-T-G-C-G-T-A-C 5' 5'T-G-A-C-G-T-A-C-G-A-T 3'
5. DNA is made of two strands that are antiparallel. If one strand runs from 3' to 5' direction the other one will go from 5' to 3' direction. During replication or transcription, whatever the process is, it will always follow the 5' to 3' direction using the 3' to 5' directed strand as the template strand. Therefore, if following is the DNA sequence 5'-CCG ATC GCA CAA-3' a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codon II. Absence of start codon III. Due to mutation b) If you want to start the translation, what change you need in the second codon (from 5' to 3' direction)? I. Substitution of C with G II. No change III. Deletion of C IV. Both I & III
2. Predict the following sequences of base in the DNA strands complementary to the single RNA strand: • 3'A-G-T-C-G-T-A-C-A-T-G 5 • 5'G-T-C-G-T-A-C-T-A-G-C 3' • 5'C-A-T-G-C-T-A-G-C-T-A 3' • 3'A-T-C-A-T-G-C-G-T-A-C 5' • 5'T-G-A-C-G-T-A-C-G-A-T 3
1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
4. Which of the following single-stranded DNA molecules would be palindromic in the double-stranded state? (A-T-G-C-C-G-T-A, G-T-C-A-T-G-A-C, A-T-G-C-T-A-C-G, G-C-T-A-T-G-A-C)
The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer sequences below would be synthesized from this strand by DNA primase to initiate DNA replication? Group of answer choices a 3'—TTAACGTCTAAGT—5' b 3'—UUAAGCUCUAAGU—5' c 5'—TTAACGTCTAAGT—3' d 5'—UUAAGCUCUAAGU—3'
Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence5'-CTTGGATATC-3'
1. Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Answer: 2. Draw the complementary RNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Answer:
1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during DNA replication. Which of the following options best represents the primer? 3’ – GCTCGACGTTCTGCGCTGTCGGGCTATGCG – 5’ a. 3’ – CGCATAGC – 5’ b. 3’ – CGCAUAGC – 5’ c. 3’ – CGUCGAGC – 5’ d. 3’ – CGUCGAGC – 5’ e. None of the above b) Which one of the following statements is true? a. The lac repressor and catabolite activator protein are both controlled by allosteric binding b. The addition of substrate to a non-competitive inhibition reaction will repress the inhibitor c. The lac repressor is inhibited by lactose through competitive inhibition d. β-galactosidase will hydrolyze galactose to form glucose and lactose e. The x-intercept of a Lineweaver-Burk plot is the numerical value for the maximum reaction velocity
What is the name of the enzyme, shown as the yellow blob circled in red, that opens the helix and adds RNA nucleotides to make the strand of RNA? O DNA Polymerase Helicase RNA Polymerase O Lactase 8 9 10 Nex 2 4 M9
1. The DNA strand which is mostly like to form DNA Z DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: A, none of the above, B, C, D 2. The DNA strand whose complementary RNA contains a stop codon starting at the 5' end DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: none of the above, A, B, C, D 3. The DNA strand of an organism living in volcanic vents is likely to be DNA W = 5' GGG GCT AGC CCC 3' DNA X = 3' ATA TAT ATA CCC 5' DNA Y = 5' TAC GTT ACG TCG 3' DNA Z = 3' ATC TTT GCCA TTA 5' Choices: W, X, Y, Z, none of the above 4. The DNA strand that is most likely to be a promoter sequence DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA TAT ATA CCC 5' DNA C = 5' TAC GTT ACG TCG 3' DNA D = 3' ATC TTT GCCA TTA 5' Choices: A, B, C, D, none of the above
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 2. If the above DNA strand is the template (antisense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 11th base was replaced by Cytosine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 2nd base was deleted. Is there an effect in the structure and function of the synthesized protein? Specify type of mutation in relation to protein function. What type of mutation is demonstrated here?c. Thymine is inserted between the 21st and 22nd gene. Is…