Q: A newly discovered gene has th 4.08 2.54 el H H 1.02 ↓ E E 1.67 E 10.8 kbp 3.94 3.66 H 10.811 E E…
A: (a) A method used frequently in labs to separate charged molecules like DNA, RNA, and proteins is…
Q: The impact of communicable diseases (infectious diseases) on human health is obvious. The sudden…
A: Being highly contagious, COVID-19 can be spread by those who are infected but are unaware of it.…
Q: Fund the KT Boundary Layer Found the DNA structure Found the DNA shape Described Natural Selection…
A: Evolution is the gradual change in the inherited traits of biological populations over many…
Q: which of the following is a source of possible bias against minoritized people in genome wide…
A: For GWAS, thousands of people are required because the majority of genetic effects found for…
Q: Your short answer should be 2-5 sentences depending on the question. (Ch. 55). Please answer both…
A: Most ecosystems have only 3 or 4 trophic levels. Some believe that humans should consume plants…
Q: Using techniques described in this chapter, how could you determine whether Archaea exist in the…
A: Introduction Archaea are single-celled microorganisms that are structurally same as bacteria.…
Q: How does position effect influence gene expression? TI The movement y! CDC The movement of the…
A: ANSWER : The correct option is: All of the above answers are correct
Q: In Eukaryotes, after the ribosomes complete a synthesis, one might expect A) a new polypeptide…
A: A cell's ribosome is an organelle. It functions as a tiny protein-making machine. Extraordinary…
Q: Using biotechnology, including PCR it is possible test many people for COVID-19 rapidly and…
A: PCR allows accurate diagnoisis of COVID-19 with theoritical sensitivity and specificity approaching…
Q: Chemicals will interact with different odorant receptors based on different... sizes of chemicals…
A: Introduction Olfactory receptors are also or odorant receptors. They are responsible for the smell.…
Q: which of the following sequencing techniques needs the highest coverage? o deep sequencing o de…
A: Deep sequencing is the process of repeatedly sequencing a genetic region—often hundreds or even…
Q: Which species are examples of intrasexual selection? Please select all correct answers. a. Elk b.…
A: Intrasexual selection is a selection in which there is competition occurs between members of the…
Q: Briefly explain how you can determine the presence of coliform bacteria in a water sample.
A: Coliforms are a type of bacteria. These organisms are normally harmless to the species or hosts they…
Q: Using the cranial and nasal index formulas below, calculate the following: Cranial Index: maximum…
A: Comparative anatomy is the study of the "similarities and dissimilarities" between various objects.…
Q: What would happen in the directionality of that activity were reversed? Would proofreading work? If…
A: Despite the remarkable accuracy of DNA replication, errors can occasionally happen, such as when a…
Q: Why sex? The comparison of parthenogenic species with sexually reproducing species demonstrates a…
A: The "life history" of an individual organism comprises important events linked to its growth,…
Q: Discuss various alternative treatment methods to overcome drug resistance
A: Drug resistance is a condition in which the effectiveness or therapeutic effect of the drug…
Q: Please match the junction type with the cytoskeletal component it is associated with Desmosome Tight…
A: Different cells' plasma membranes contain structures called cell junctions. Animal cells include…
Q: Cnidaria (jelly fish) have neuromuscular (nerve net) cells in their ectoderm. These cells are…
A: Cnidaria is a phylum of aquatic animals that includes jellyfish, sea anemones, corals and…
Q: Site of transcription Choose a match
A: All of the given matches are correct but Transcription takes place in the nucleus. An RNA…
Q: What is the purpose of the confirmed test in an experiment designed to test for coliform bacteria?
A: Coliform bacteria are either nonmotile or motile, Gram Negative, bacilli bacteria. These are found…
Q: Concerning interface drug reactions, which statement is false? a. Most are caused by type II…
A: Dyskeratosis: Clinically characterized by the trio of aberrant nails, reticular skin pigmentation,…
Q: thank you and hava a nice day :) Article: Can Nanotechnology Help to Control the Cytokine Storm?…
A: This article is about covid-19 pandemic and how it is responsible for killing so many people. The…
Q: 2. Compare and contrast these energy transformations in Photosynthesis. Light reactions…
A: Photosynthesis: The energy and electron sources for photosynthesis's light processes are sunlight…
Q: Looking at this sample of a fungus, to what main group would it belong to? The first pic is the…
A: Studying fungi can be very beneficial for us as Fungi play an important part in "environmental…
Q: .What is biomass as a source of energy? Is it considered as renewable source of energy?
A: Biomass energy is the energy which is generated by using living mass. Biomass is a renewable energy…
Q: ad this story and identify the different aspects of the scientific method by choosing the Cement…
A: In order to prove something scientifically one conducts experiment on the basis of the observations.…
Q: CHOPPY Maleae Gillenieae Kerrieae Exochordeae Sorbarieae Amygdaleae Lyonothamneae Spiraceae…
A: Introduction:- The classification of different organisms is based on the two biological approaches -…
Q: کو اتار کر کے TATAAA box Translation initiation codon Intron 1 Exon 2 Intron 2 A. 5' Capping defect…
A: The answer is option The answer is option (E). Protein truncation.
Q: Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what…
A: Introduction The process by which a gene's information is used to produce either RNA molecules that…
Q: question: Can you summarize and explain for me what you want to tell in the article below? When I…
A: Photodynamic therapy (PDT) is treatment that uses drugs called photosensitizers and combine light…
Q: Which of the following is part of the extracellular matrix? A) All of the other answers are correct…
A: The fundamental building block of all living things is the cell. The trillions of cells that make up…
Q: A technician wants to amplify DNA from a patient sample. However, the lab is not equipped with a…
A: DNA amplification is a technique used to make multiple copies of a specific DNA sequence. It is…
Q: Where did you answer the last 2 questions?
A: 5'UTR stands for untranslated region at the 5' end of the DNA sequence. 3' UTR stands for…
Q: List two preparations shown every month by the uterus in anticipation of pregnancy in humans.
A: Introduction: Uterus Also called womb is an important organ of female reproductive system.its main…
Q: Antibodies are found: O OOOO in the blood plasma on white blood cells in fibrinogen on red blood…
A: Antibodies are the proteins molecules that are synthesized by the B cells in the blood in response…
Q: Describe Scientific Method
A: A research proposal is a document that specifies the aims of the research and the techniques that…
Q: Use the following information to answer the next question. A Venn Diagram Showing the Relationship…
A: All the hereditary information is passed from one generation to another via genetic combinations.…
Q: If bioelectrical impedance analysis cannot be carried out, suggest in detail how we can estimate the…
A: A method called bioelectrical impedance analysis (BIA) uses the speed at which an electrical current…
Q: When you cross a female carrier for Color Blindness XCXc with a Color Blind male XcY, what is the…
A: An imbalance in how one or more light-sensitive cells (known as cones) located in the retina of the…
Q: Central African chimpanzees (Pan troglodytes troglodytes) and bonobos (Pan paniscus) are two…
A: The events that are responsible for the evolution of species from the ancestral population is called…
Q: A pregnant woman visits the doctor. The GP decides to request ultrasound imaging to check on the…
A:
Q: Explain what this definition of an organ means “an organ is a collection of many tissues working…
A: Humans and many other complex organisms require unique systems to carry out various functions within…
Q: 3'-TAC TGA GCA AGA TTA CAT ACT-5' Write down the mRNA sequence for the given DNA sense strand…
A: A mutation in both copies of the HBB gene results in sickle cell disease (SCD), a hereditary…
Q: the human eye that contribute to its ability to capture images of the real world.
A: Eyes are the visual organs. The eyes of most vertebrates are placed laterally upon the head,…
Q: Define sexual selection among primates (including both female choice and male competition) and…
A: Sexual selection was a concept given by Darwin. Sexual selection is related very much to the…
Q: Signs and symptoms of Asthma in detailed
A: Introduction Your airways may swell, become more constricted, and create more mucus if you have…
Q: Mosquitoes and ticks transmit pathogens to mammals. For each vector, explain how the life cycle,…
A: The illnesses brought on by vectors are known as vector borne diseases. A vector, such as a…
Q: Evolution of Prokaryote into the Eukaryote cell type. A. What are the significant the significant…
A: The major changes that are represented in the evolution of prokaryote cells into eukaryote cells…
Q: What are the different anatomical joints used in a block start for a sprint? What is happening at…
A: Sprint athletes brace their feet against starting blocks at the beginning of a race to prevent them…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- A biologist examines a series of cells and counts 160 cells in interphase, 20 cells in prophase, 6 cells in prometaphase, 2 cells in metaphase, 7cells in anaphase, and 5 cells in telophase. If the complete cell cycle requires 24 hours, what is the average duration of the M phase in these cells? Of metaphase?Which of the following does not occur during mitosis? (a) (b) (c) (d) Chromatin condenses and forms chromosomes. Chromosomes move to the equator of the cell. Spindle fibres pull homologous chromosomes to opposite poles of the cell. Two new nuclei are formed that have two full sets of genetic information.A biologist examines a series of cells and counts 160 cells in interphase, 20 cells in prophase, 6 cells in prometaphase, 2 cells in metaphase, 7 cells in anaphase, and 5 cells in telophase. If the complete cell cycle requires 24 hours, what is the average duration of the M phase in these cells? Of metaphase?
- Name the stage of cell cycle at which one of the following events occur:(i) Chromosomes are moved to spindle equator.(ii) Centromere splits and chromatids separate.(iii) Pairing between homologous chromosomes takes place.(iv) Crossing over between homologous chromosomes takes place.1) after mitotic cell division, each daughter cell must receive ______ amount of DNA 2) DNA+ associated proteins make up ____ in eukaryotic cells 3) Normal members of the same species have the same number of ____ in their cells 4) somatic cells are ____ 5) germ cells are______ 6) _______ mean they contain two copies of each chromosome 7) ______ mean they contain one copy of each chromosome 8) each cell in our bodies from its birth tell its death is on a pathway called the ____ ANSWER OPTIONS: a. cell cycle b. twice the c. the way of the cell d. the same e. haploid f. chromosomes g. diploidWhat are chromatids and How many chromatids do humans have??
- A cell in G1 of interphase has 8 chromatins. How many chromosomes and how many DNA molecules will be found per cell as this cell progresses through the following stages: a) metaphase b) anaphase c) after cytokinesis in mitosis d) metaphase I e) anaphase I f) metaphase II g) anaphase II h) after cytokinesis of meiosis II1) what is meant by “there is no such thing as a typical cell?” 2) which part of the cell cycle does the cell spend the least amount of time in? Why do u think that is? 3) why would a cell ever want to destroy itself? 4) how long does a cell live before it undergoes mitosis? 5) if cells can constantly replace themselves, why is a heart attack (which kills cardiac muscle cells) so devastating? 6) what type of cells never undergo mitosis? 7) what makes stem cells particularly interesting to researchers? 8) how might stem cells be used to repair brain or heart damage, even though these cells do not undergo mitosis? 9) why do you think beauty experts would also be interested in stem cells? 10) what is the connection between cancer and mitosis? 11) why is it so difficult for your body to battle cancer? 12) why does you hair fall out of the chemotherapy?A cell containing 48 chromatids at metaphase would, at its completion, produce two nuclei each containing how many chromosomes?
- What is the difference between a chromosomes and a chromatids? a) there is no difference they are the same b) chromatids is always one stand of dna chromosomes can be one or two strand depending on the phase of the cell cycle c) chromatids is always two strands of dna chromosomes can be one or two stands depending on the phase of the cell cycle d) chromosomes are homologous chromatids are identicalWhat is cell divison in biology?Which of the following is FALSE about mitotic cell division and mitosis? O A. Mitotic cell division is 6 stages: Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis while mitosis is 4 stages: Prophase, Metaphase, Anaphase, Telophase. O B. The terms mitotic cell division and mitosis are the same and they can be used interchangeably to refer to cells dividing to make more cells. O C.A mitotic cell division includes mitosis and mitosis is part of a mitotic cell division. O D. During mitotic cell division, 1 cell divides into 2 cells and during mitosis, 1 nucleus divides into 2 nuclei.