Human bipedalism is associated with skeletal structure adaptations that are distinct from the skeletal structures of other primates. Classify each of the anatomical characteristics as belonging to either humans or chimpanzees. wide foot S-shaped spine Chimpanzees narrow pelvis Answer Bank central-positioned foramen magnum forward-shifted foramen magnum curved spine Humans narrow foot broad pelvis
Q: Examine the phylogeny to determine which of the boxed off groups are monophyletic, paraphyletic, or…
A: A phylogenic tree is a schematic diagram which shows evolutionary relationship of the various…
Q: what does the second number in the chromosomal location indicate like the number right before the…
A: It is the specific location of the gene which provides for information of the particular segment of…
Q: The role of allolactose in the lac operon
A: Lac Operon:This is a classic example of a gene regulation system found in E. coli.The key…
Q: DNA replication is semi-conservative, this statement means that Question 6 options: a) the…
A: DNA replication is the process by which double-stranded DNA is duplicated. The replication of DNA is…
Q: If the clamp loader on DNA Pol III were not efficient at loading the new clamp, which strand of the…
A: DNA Polymerase III is a complex protein involved in DNA replication. It has several subunits,…
Q: In mallard ducks, Anas platyrhynchos, plumage is under control of a single gene with three alleles:…
A: If a gene exists in more than two alleles such condition is called multiple allelism. Eg. Blood…
Q: There might be life on Europa because it has an atmosphere that contains oxygen just like the Earth”…
A: Europa is one of Jupiter's biggest moons, renowned for having the fascinating possibility of…
Q: Write down the energy content in kilo-calories (kcal) from one gram of fat, one gram of carbohydrate…
A: In the context of nutrition and dietary science, it is essential to understand the energy content of…
Q: Draw and label the mitotic phases (prophase, metaphase, anaphase & telophase) and meiotic phases…
A: The process in which a cell divides itself to form daughter cells is known as cell division. Cell…
Q: See image
A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT
Q: can derive nourishment from eating clothing made of natural fibers such as wool (which is rich in…
A: Clothes moth larvae possess a unique ability to nourish themselves by consuming clothing made of…
Q: What is the size in µm of a cell that is 135mm wide in my photo? The scale bar in the photo is…
A: A microscope is a scientific instrument that allows us to see objects that are too small to be seen…
Q: Answer the following “cause-effect” true/false questions using the answer key: A: Only statement A…
A: The questions inquired are related to the cause-effect relationship between two statements, each…
Q: Case #5: Native Americans and Type O Blood Modern Native Americans have very high frequencies of…
A: Evolution is described by a phenomena in which lots of changes accumulate over thousands and…
Q: Give typed explanation Put the events of a single cross-bridge cycle in the proper order. Start…
A: Cross-bridge cycle explains the calcium-based interaction of actin filament and myosin during…
Q: Briefly explain what occurs in G1 phase including how and why this phase is important in the cell…
A: A cell cycle is a structured and monitored process by which one single parental cell functions,…
Q: Which of the statements are true regarding hybridization? Select all that apply. Hybridization…
A: Hybridization is the process where organisms from two different species are mix or breed together.…
Q: carry the father’s genetic information
A: Genetic infromation refers to the informations which is stored in the DNA. DNA can code for proteins…
Q: evolution genetic variation Hardy-Weinberg equilibrium genetic drift adaptations sexual reproduction…
A: Evolution is the gradual process through which living organisms change over time, typically due to…
Q: Hybrid populations such as those seen between towhee species complicate the biological species…
A: According to the biological species concept, species is defined as the group of organisms that can…
Q: Imagine you are a college student volunteering for a nonprofit cancer organization that houses…
A: Cancer is a condition characterized by uncontrolled cell growth and division in the body. These…
Q: 5) Fernando has type O blood and Darla has type A. Darla's brother has type O, while both of her…
A: Blood group refers to the type of antigen carried on the Red Blood Cells. In humans there, are two…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: Fermentation is the process in which a microorganisms converts carbohydrates like starch or sugar…
Q: Part A Mark the location of each antibiotic's action by dragging the labels onto the diagram of a…
A: Numerous mechanisms exist by which antibiotics might affect ribosomes, the cellular machinery in…
Q: A short fragment of a double-stranded DNA molecule is 100 nitrogenous base pairs in length. Adenine…
A: In the world of molecular biology, the structure of DNA holds a central role. The stability and…
Q: Drag each label into the appropriate bin. Reproduces its own kind Requires another individual to…
A: An earth ecosystem consists of both living and non-living organisms. The abilities for interaction,…
Q: Assume researchers are able to isolate the intact mRNA for a gene called qrs. The qrs mRNA isolated…
A: Messenger RNA is synthesized with the help of RNA polymerase taking the help of template strand of…
Q: To which other species of storm-petrel is H. matsudairae, the cold-season breeder on Japan, least…
A: This is a representation of a phylogenetic tree in which different evolutionary relationships are…
Q: Why is it necessary to sterilize the loop between streaks when streaking for single colonies?
A: Streaking is a technique used to isolate a pure strain from a single species of microorganism, often…
Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…
A: Chromosomal aberration - It is defined as the change in chromosome structure and number.Change in…
Q: 6. What volume of a 9% NaCl solution is needed to prepare 100 mL of a 0.9% NaCl solution?
A: The serial dilution process is routinely performed in the biology laboratories to calculate the…
Q: Answer the following “cause-effect” true/false questions using the answer key: A: Only statement A…
A: According to the guidelines of Bartleby,"Since you have posted multiple questions, we will provide…
Q: What differentiates cells throughout the body?
A: Cell differentiation is the process by which unspecialized or undifferentiated cells, often referred…
Q: Which of the following citric acid cycle intermediates is decarboxylated during the operation of the…
A: The Krebs Cycle/ Tricarboxylic acid cycle/ Citric acid cycle is an important pathway of cellular…
Q: 2.3. Locomotor and Bladder Function Locomotion scores in all dogs gradually increased with the…
A: In Figure 3, the gait ability and locomotion scores for four dogs are presented:
Q: How can a skull of a specimen be classified as a Strepsirrhine?
A: Strepsirrhine are identified by their long snout and wet nose. This group includes lemurs and…
Q: Tackle the question of how we determine membership in a particular species?
A: Definition A species is a group of organisms having similar features. A particular species has…
Q: Let's pretend that there is a community called Zygozia. They say that they founded their small…
A: The process by which the frequencies of genetic features alter over generations within a population…
Q: The amount of DNA in a differentiating oligodendrocyte in M-phase is 210pg. How much DNA would be…
A: The quantity of DNA within a cell changes during the cell cycle.The cell cycle is a highly…
Q: Chemolithrophs near hydrothermal vents support a variety of other life forms there. Explain now…
A: Chemolithrophs are the microorganisms that generate energy by the oxidation of inorganic molecules…
Q: Explain why K+ channels not allow Na+ to pass even though Na+ is a smaller ion, and Na+ and K+ are…
A: Potassium channels are specialized membrane-spanning proteins made up of four subunits that create a…
Q: Question 21 In plants, ____ are produced by meiosis. flowers spores Gametophytes sporophytes…
A: The sexual reproduction in plants is responsible for the production of haploid (n) male (polen) and…
Q: Provide details and explain "Epidemic of Absence by Moises Velasquez Manoff microbiome on the gut…
A: Moises Velasquez-Manoff is the author of the book "Epidemic of Absence: A New Way of Understanding…
Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…
A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…
Q: Suppose a mutant RNA polymerase Il is used that lacks one of the phosphorylation sites on the…
A: The production of RNA from the DNA template is known as transcription or gene expression. The main…
Q: Which one of the following is not true about PEA medium? Select one: a. Contains sodium…
A: PEA medium is a specialized agar used in microbiology to isolate and grow Gram-positive bacteria…
Q: What is the best desccription for these tissues: Cartilage, Vascular (Blood) Tissues, Reticular…
A: Tissue can be described as a group of similar cells that usually have a common embryonic origin and…
Q: QUESTION 5 Which of the following is (are) problematic when the goal is to construct phylogenies…
A: Polyphyletic taxa include groups of organisms that share a common ancestor but also include some…
Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…
A: Lipid metabolism is the process by which the body breaks down and synthesizes lipids. Lipids are a…
Q: Three ships are carrying a population of rats as stow aways in their holds on a trans-Atlantic…
A: Gene flow, also known as gene migration or allele flow, is the transfer of genetic material…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Whereas some of the skeletal transitions to bipedality appear to be isolated adaptations, others clearly occurred in tandem. A good example is the reorganization of the pelvic girdle as it correlates to a change in the vertebral column. For this question, explain one way in which a change in the former facilitated a change in the latter. How did this change in the shape of the vertebral column aid in bipedal locomotion/posture? (100-150 wds.)Comparative Anatomy Shown below are images of the skeletal structure of the front limbs of 6 animals: human, crocodile, whale, cat, bird, and bat. Each animal has a similar set of bones shown by shading. --humerus ulna radius -carpal metacarpal whale crocodile phalanges human bird bat catWhich of the following represent functions of the anatomical modifications toward more efficient bipedalism in hominins? Group of answer choices UV protection Brachiation Increased stride Shock absorption Balance Binocular vision Enchephalization
- Which of the following are traits are observed in Homo erectus crania (select all that apply)? Group of answer choices long and low overall cranial shape robust nuchal torus maximum cranial breadth below the ear large canines large supraorbital browridge high degree of post-orbital constriction sagittal crestDescribe the change in position & design of the long bones (stylopodia & zeugopodia) from a straddle-posture to an upright posture in a mammal. What other taxon has analogous changes in pelvis & limbs that go along with being bipedal?Suppose archaeologists discover human skeletal remains in Ethiopia. Examination of the bones suggests that the remains represent four individuals. Two of the skeletons have a broad pubic bone and a pelvis with a wide pubic arch. Within the two groups defined by pelvic differences, smaller skeletons have bones with evidence of epiphyseal plates, but larger bones have only a thin line where the epiphyseal plates should be. Give the age group and sex of the four individuals in the find.
- Select all of the traits provided below that appear in this specimen: -occipital bun -large cranial capacity -canine fossa -sagittal keeling -large arching browridges -large nuchal torusThe Ardipithecus ramidus specimen, nicknamed Ardi, was a great find because it contained a large portion of the skeleton. From this skeleton we learned that ... O Ardi had an opposable big toe, like an ape O All of these answers are true O Ardi's nuchal region of the skull was oriented downward like a biped O Ardi had an angled femur, like a bipedcomparison of the skeletal features of pigeons and cats Skeletal Features Pigeon Cat Bone Density (light/ dense) Vertebrae (number) Forelimb Hindlimb Tail
- Characterized by a pelvis with the pelvic bones radiating from the center Ichthyosaurs Plesiosaurs Ornisthicians Pterosaurs SaurichiansList four anatomical differences between chimpanzeesand humans, and explain how these changes facilitatedwalking upright.What do scientist infer from the similarities between these stuctures? Humerus- Radius Ulna- Carpals- Metacarpals- Phalanges- Human Cat Нorse Bat Dolphin shutterstock.com 1603198606