Given this viral mRNA, which model represents the correct (+)ssRNA genome from which it was made? mRNA AUAUUUGCG.... O (+) AUAUUUGCG (+) UAUAAACGC (+) AUAUUUGCG... (+) UAUAAACGC
Q: Looking at the first picture, answer the questions on the second picture
A: Answer is given below Explanation:
Q: St. Aurelius Augustine, in his theodicy attempting to reconcile freedom and determinism, recognized…
A: The question is asking about the theological implications of St. Aurelius Augustine's theodicy,…
Q: Aristotle classified all tracheophytes, with water-conducting stems and nutritive souls, but not…
A: Aristole classified all tracheophytes,which posses water-conducting stems and nutritive souls but…
Q: Why is the Atlantic cod listed as "Vulnerable" on the IUCN Red List of Threatened Species, but only…
A: The objective of the question is to understand the discrepancy between the classification of the…
Q: How many mL of the 1 M glucose stock solution do you need to prepare 100 mL of a 1 mM glucose…
A: After dilution, the dilution factor represents the number of times the original concentrated stock…
Q: According to Aristotle, which of the following categories of living organisms possessed a nutritive…
A: The objective of the question is to identify the category of living organisms that, according to…
Q: Alfred Gierer and Gerhard Schramm exposed plant tissue to purified RNA from tobacco mosaic virus,…
A: Alfred Gierer and Gerhard Schramm's experiment demonstrated that purified RNA from tobacco mosaic…
Q: Forces are always acting on the genes of a population, causing natural selection to occur. Describe…
A: The objective of the question is to understand the forces that affect the genes in a population,…
Q: Normal pigmentation dominates no pigmentation (albino). For an organism to exhibit color, it must…
A: So, the bull with the red heterozygous allele has one red allele and one for no color (albino).…
Q: FREQUENCY 60 40 20 0 88842 140 120 100 80 1 3 5 7 9 11 LITTER SIZE 13 15 Which of the following best…
A: Both k and r are strategies for survival. In k selected small number of offspring is produced with…
Q: The “mean-speed theorem” for calculating average velocity under constant acceleration, developed by…
A: The objective of the question is to understand the 'mean-speed theorem' for calculating average…
Q: What is the difference between Eukaryotic cells and Prokaryotic cells in terms of how gene…
A: We must first grasp how a gene codes for a functional protein in a cell to comprehend how gene…
Q: In your response explain how your species communication would potentially enhance the fitness of…
A: Understanding the complex tapestry of communication inside primate species gives an intriguing lens…
Q: Cross a heterozygous tall, true-breeding yellow podded pea plant with a homozygous tall, hybrid…
A: The objective of this question is to determine the possible genotypes and phenotypes of the…
Q: 1a.) Please take a position for-or-against genetically modified agricultural products. 1b.) Be sure…
A: The provided links discuss various aspects of genetically modified organisms (GMOs), cancer…
Q: Label the cell below
A: The objective of the question is to identify the part of the cell that controls the movement of…
Q: Match the cell organelle with its function. Put responses in the correct input to answer…
A: The objective of the question is to match each cell organelle with its corresponding function.
Q: I completed the chart, and I'm supposed to figure out the unknown bacteria, there are 12 unknown…
A: AnswerBased on the information provided in your chart, let's compare the characteristics of your…
Q: Identity Identify the pointed structure a. JG cells b. Intramesangial cells c. Extramesangial cells…
A: The pointed arrow refers to the Optioin d. macula densa for several reasons:Histological Features:…
Q: Refer to the relative proportions diagram in the first picture. 1. To help reveal patterns in the…
A: Note:- As per the honor code we are solving the first three parts of the questions, Please repost…
Q: Q1: a. Write down the best way to examine epithelial tissues under microscope by what the stains…
A: a.Epithelial tissues are examined under a microscope using a staining technique called Hematoxylin…
Q: Interpret this: what does this say about b-galactosidase production? Does Lac mutant exhibit it?
A: Lactose breakdown in prokaryotic cells is regulated by the activity of different enzymes that are…
Q: STEM WOrkplace Practices Q4
A: The objective of the question is to understand the relationship between pH and the concentration of…
Q: 1. Write in a summary paragraph, to identify the test/stain in Microbiology. 2. Write in a summary…
A: Answer:1.In microbiology, several tests and stains are used to detect microorganisms. These include…
Q: GQ8
A: The question is asking us to understand the effect of methylation of genes in prostate cancer cells…
Q: To be able to properly analyze a sample of DNA, you need to have at least 1 µg of the DNA of…
A: The polymerase chain reaction (PCR) is a molecular biology technique for amplifying particular…
Q: Heavy Metals were identified as environmental pollutants much earlier than most trace level organic…
A: Yes, heavy metals have been recognized as environmental hazards for a much longer time compared to…
Q: Start with a small population (n= 5-50) with the # of populations set to 1. Leave all other…
A: The objective of the question is to understand the effects of different migration rates on a small…
Q: Picture in white is acid fast other picure is negative stain so far this is the information I…
A: The Acid-Fast Stain is a laboratory technique primarily used to identify bacteria that belong to the…
Q: In the podcast about scientific literature, Prof Fraser and Prof Clare described the parts of a…
A: The objective of the question is to identify the correct description of the 'discussion' section of…
Q: A 3.0 L batch bioreactor is used to grow E. coli bacteria, which have an initial concentration of…
A: To address this question, we'll break down the calculation into a few steps to decide the…
Q: What are Canada's land and ocean biodiversity targets for 2030? 30% of…
A: The question is asking about the biodiversity targets set by Canada for the year 2030. These targets…
Q: 3:08 1 Back Pulse BIOL 1230-General Biology 1 BIOL 1230-General Biology 1 Question 1 H+ is an…
A: QUESTION 1Here's how I arrived at the answer that H+ is a cation:Charge: The symbol "+" in H+…
Q: If the mRNA sequence is ATG GGG AGC What is the anticodon sequence?
A: To find the anticodon sequence for the given mRNA sequence "AUG GGG AGC", we need to complement the…
Q: According to Aristotle’s density equation, if 4.686 grams of the sugar glucose (C6H12O6) occupies a…
A: 4. 1.562 grams/cm3Explanation:
Q: GQ7
A: The question is asking to determine the number of exons in a gene given the number of introns. In…
Q: A small lake is capable of supporting both bluegill and smallmouth bass. These two bony fish species…
A: Carrying capacity: It can be defined as maximum ability of a specific area to withstand the maximum…
Q: According to Aristotle, which of the following categories of living organisms possessed a nutritive…
A: The ancient Greek philosopher Aristotle made significant contributions to various disciplines,…
Q: What environmental issue is associated with tropical rainforests due to human activities like…
A: The question is asking about the environmental issue that is associated with tropical rainforests…
Q: what the following does for/has to do for DNA : 5-3 ,3-5, Nitrogenous Base, Deoxyribose, Hydrogen…
A: The terms mentioned in the question are all related to the structure and function of DNA…
Q: 52539748 chr6 chr11 chr21 chr2 19536840 79940246 39633040 26243967 chr8 chr21 chr9 chr10 chr9 chr10…
A: Identification of Differentially Expressed Genes in Breast Cancer Using RNA -SeqThe differential…
Q: Which of the following lists correctly prioritizes by importance (highest to lowest) the systems,…
A: Spatial orientation in flight refers to the ability of an organism to maintain its position and…
Q: the context of this image is that it is from the GEO website and what to do is to write 500 words…
A: Breast cancer is the most common malignancy in women globally, accounting for over 30% of new cancer…
Q: A chromosomal abnormality where the entire set is either increased or decrease in number. ○…
A: Ploidy is the count of chromosomal sets in a cell or organism. Humans and many other species often…
Q: Which Roman Catholic Order is correctly matched with its favored metaphysical doctrine? the…
A: The question is asking us to identify which Roman Catholic Order is correctly associated with its…
Q: Which of Aristotle’s four causes is a definition of the substance of which something is composed?…
A: The objective of the question is to identify which of Aristotle's four causes refers to the…
Q: Please answer the following question and explain Q1. If MacLeod and McCarty had accidentally…
A: DNA - All genetic information is carried by deoxyribonucleic acid, or DNA. It codes genetic…
Q: What type of sensory receptor in the skin in the encircled structure? a. Pacinian corpuscles b.…
A: Receptors are specific structures that are present at different locations in our body. When…
Q: Your broth culture contains 471,612,048 bacteria/mL. Design a dilution series that would result in…
A: To ensure an accurate count of bacterial colonies on agar plates, it's crucial to design a dilution…
Q: 2. Categories besed on its shape Draw a brachycephalic skull and a dolichocephalic skull. Explain…
A: Note:- Since you have posted multiple questions, we are solving the first one for you as per our…
Step by step
Solved in 3 steps
- b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) 5'TATTATAACGCATGACGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3'-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5' Promoter (i) (ii) TSS (iii) Terminator Figure 2 Which DNA strand (the top or the bottom) is used by polymerase as a DNA template? List the mechanistic steps that can trigger the initiation of transcription by the Sigma Factor. What are the amino acids translated from the resulting mRNA? Indicate the amino (NH₂*) and carboxyl (COO) termini of the polypeptide chain.Researchers have been determining the nucleotide sequences of variant forms of SARS-CoV-2, looking for versions of the virus that might be more easily transmitted between humans or that might be more deadly. (a) For example, one mutation in a viral gene changed a GAU codon to a GGU codon. How does this change affect the sequence of the polypeptide encoded by that gene? (b) In another variant form of the virus, a gene is missing six consecutive nucleotides. How would this change affect the sequence of the polypeptide encoded by that gene? (c) In another coronavirus variant, the spike protein (the prominent protein on the surface of the virus) contains a histidine residue where an aspartate (aspartic acid) residue should be. Describe a point mutation in the coronavirus genome that could have caused this change in the spike protein.b) Shown below is a short gene of an unknown bacteria genome (Figure 2). (Note: Transcription starts at Transcription Start Site (TSS).) TSS 5'-TATTATAACGCATGAGGAGCCATGCATTATCGGTATATGCACTGACCCGGAAAGGCTCCTTTTGGAGCCTTTTTT-3' 3-ATAATATTGCGTACTGCTCGGTACGTAATAGCCATATACGTGACTGGGCCTTTTCCGAGGAAAACCTCGGAAAAA-5 Promoter ********* Terminator Figure 2 Based on the DNA sequence of terminator, draw the structure of the hairpin loop that will be formed during the end of transcription.
- The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' AG FLYS viruses have code (I) and some chickens' viruses have code (I1). (1) 5' CAUGAUAUUGUACUUU 3' (1I) 5' GAAUGGAACUGCAACUC 3' Translate the partial sequence for type I flu protein. "Be sure to start translation at the start codon! Second letter C UUU UUC J UUA UUG J UCU UCC Ser UAU Tyr UACJ UAA Stop UGA Stop UAG Stop UGG Trp G Phe UGU UGC Cys UCA Leu UCG CUU CAU CGU CGC CCU C ССА CCG CUC CUA CAC His Leu Pro CAA GIn CAGJ CGA FArg CGG CUG AAU Asn AAC S ACU ACC ACA AUG Met ACG AUU AGU Ser AGA Arg AGGJ AUC lle A AUA Thr GUU GCU GAU GGU GAC Asp GUC GCC GGC G Val Ala GAA Gly GCA GCG GGA GUA GUG GAGJ Glu GGG O Glu - Trp - Asn - Cys - Asn O Met - Glu - Leu - Gin - Leu O Met - lle - Val - Leu - Gly O Met - lle - Leu - Tyr - Phe O His - Asp - lle - Val - Leu First letter Third letterFor the following sequence design the forward and reverse primer... explain and justify your answer. Full sequence would be: 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg…The genome of SARS-CoV-2 is a single-stranded sense (coding) mRNA that is translated into many functional and structural proteins required for the replication and assembly of the virus, including the famous spike protein. Comparing the sequence to that of SARS-CoV-1 and a number of other beta-coronaviruses reveals that by far the most conserved sequence within the entire ~30,000 nucleotide mRNA genome is located in the 3'-UTR, near the end of the message. The difference between that sequence in the original isolates of SARS-CoV-2 is only 1 in 50 nucleotides. What is the most likely explanation for this high degree of sequence conservation? The mRNA in this region encodes for a protein with a required proteus site to make the mature viral coat protein that participates in membrane fusion, without which the virus cannot propagate. The mRNA in this region encodes for an essential protein whose fold cannot tolerate amino acid substitutions. The mRNA in this region is part of a required…
- Following replication of the viral RNA, the mRNA coding for the Spike protein is produced. The part of this MRNA that will be efficiently translated is 3,822 nucleotides long. The 5' and 3' ends of the mRNA that will be further translated is represented below. 5'auguuuguuuuucuuguuuuauugccacuagu. . ....caaauuacauuacacaluaa 3' a) Name below the sequence, which is underlined as well as the squared sequence. b) Using the genetic code table inserted above, write the 3 C-terminal amino acids of the Spike protein. 2nd base 3rd base 1st base U A G UUU UCU S UAU Y UGU C UUC F UCC S UAC Y UGC C U UUA UCA UAA Stop Stop S UGA Stop A UUG UCG S UAG UGG W G CUU CCU CAU H CGU R CỤC ССС САС H CGC R C C CUA ССА P САА CGA R A CUG СCG CAG CGG R G AUU ACU T AAU AGU AUC А T AAC N AGC A AUA ACA T AAA K AGA A AUG M ACG AAG K AGG R G GUU V GCU A GAU D GGU G U GỤC V GCC A GẠC D GGC G G GUA V GCA A GAA E GGA G A GUG V GCG А GAG E GGG G G c) What is the length (in amino acids) of the Spike polypeptide? >>>>Below is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' viruses have code (1) and some chickens' viruses have code (II). (1) 5' CAUGAUAUUGUACUUU 3' (II) 5' GAAUGGAACUGCAACUC 3' nal Translate the partial sequence for type I flu protein. "Be sure to start translation at the start codon! Second letter U C G UUU Phe UUC. UUA UUG FLeu UCU UCC Ser UAU UAC Tyr UGCJoys UAA Stop UGA Stop UAG Stop UGG Trp G UCA UCG CUU CCU CC CA CCG CAU His CACJ Pro CAA1 GIin CAGJ CGU) CGC CUC Leu CUA CGA Arg CGG CUG ACU ACC ACA AUG Met ACG AAU AACJ AAA AAGJ AGU Ser AGC. AUU Asn AUC le Thr AUA AGA Arg Lys AGG. GUU GUC Val G GUA GUG GCU GCC GCA GCG GGU) GGC GAU Asp GAC. Ala GAA) Glu GAGJ GGA Gly GGG O Glu - Trp - Asn - Cys - Asn O Met - Glu - Leu - Gin - Leu O Met - lle - Val - Leu - Gly O Met - lle - Leu - Tyr - Phe O His - Asp - lle - Val - Leu First letter Third letter
- Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr. A mutation in this gene has a G inserted after the second C in the strand. How will this mutation affect the phenotype? A)This will affect the phenotype because although most of the protein will be identical, the first amino acid will be different. B)This will not affect the phenotype because only the second amino acid is different from the original protein. C)This will not affect the phenotype because the protein will be identical to the original protein. D)This will affect the phenotype because all of the amino acids after the first one will be different from the original protein.