Give typing answer with explanation and conclusion there are many patients who have atrial fibrilation who don't even know they have it or only show symtoms some of the time and dont attribute them to a heart condition. when would they be most likely to experience symtoms( palpitation, shortness of beath, chest pain)? why

Q: What role does the microbiome play in mediating ecological interactions between organisms in an…

A: Microorganisms are an integral component of life on earth and may coexist with almost any living…

Q: Viruses cannot be grown in standard microbiological culture such as broth and agar. They need to be…

A: Cytopathic effectsIt is defined as the morphological changes produced by the virus in the cell line…

Q: Your heart is a single organ, but it acts as a double pump in the human body explain this important…

A: The human circulatory system consists of a muscular chambered heart, a network of closed branching…

Q: Order: streptomycin 500 mg IM daily for 8 days. If you have vials of this antibiotic that are…

A: One must compute the dosage based on the vial's concentration and the recommended dose in order to…

Q: Below are the reduction half reactions for chemolithoautotrophic denitrification, where hydrogen is…

A: The question address the process of the chemolithoautotrophic denitrification, where the  hydrogen…

Q: Nemo's mother produced thousand of eggs in hopes that at least a few would survive into 7)…

A: The term "life history strategies" refers to the different adaptations and reproductive behaviours…

Q: Please help me with the matching question below - it is based on genomics/developmental biology.

A: 1. Spinal cord - E. Ectoderm   - The embryonic precursor of the spinal cord is the ectoderm.2.…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: 6. The prechordal plate &/or the anterior visceral endoderm plays an important role in…

A: In the egg or within the mother uterus the early developmental stage of an animal is known as…

Q: Discuss each of the following topics and provide appropriate example/s of each where necessary.…

A: Note - we are supposed to answer three subpart of a question, please repost other questions…

Q: Which restriction enzyme is best suited for cloning in pUC8?

A: The restriction enzymes are specific endonuclease that cut the double stranded DNA from the middle…

Q: Question 13 A frameshift mutation could result from O A) a base insertion only B) a base deletion…

A: Mutations are basically unexpected alterations in the genetic material. They can be beneficial or…

Q: Compare and contrast the structure and function of the following among bacteria and eukaryotes: a.…

A: In bacteria, ribosomes are cellular structures responsible for protein synthesis. They are composed…

Q: When you use a simple stain like Methylene blue, how can you tell between one bacterium and another…

A: Simple stains refer to use of single stain and no differentiation can be made on the basis of colour…

Q: Coated pits" are formed as a result of

A: Coated pits are formed when specific cell surface receptors bind to their ligands, which causes the…

Q: Draw a cladogram with the following eleven animals written across the top, representing the…

A: Cladogram is a diagrammatic illustration which determines how one species is related to another…

Q: Part IV: 1. What affect would cyanide have on the electron transport chain and the production of…

A: The electron transport chain (ETC) is an essential component of cellular respiration, the process by…

Q: 14. Complete the following table: Enzyme Lipase Peptidase Where it is produced Salivary glands…

A: The process in which the organs take food , Water and break them into small substance to use the…

Q: Part III: 1. For each metabolite listed in the table, describe its role in cellular respiration? a.…

A: Cellular respirationThis is a biological pathway in which glucose is breaks down to release ATP.…

Q: When you exercise, your heart speeds up, and a greater volume of blood is pumped around the body to…

A: Heart rate refers to the number of times the heart beats per minute. It is a measure of the…

Q: How does dilution affect the concentration of enzymes and their catalytic activity in a biological…

A: Dilution refers to the process of reducing the concentration of a solute in a solution by adding…

Q: For questions 1-3; indicate whether the sentence or statement is true or false. If false, rewrite…

A: Living organisms need energy for doing cellular activities and this energy is produced by the…

Q: List the events that occur when a nerve stimulate the next neuron. impulse crosses the synapse to

A: Synaptic transmission is the process by which a neuron communicate with adjacent neuron. Information…

Q: 3' 5' H 5' A B XIX 3' D | Pu F G for 3' 5'

A: DNA replication is a process by which DNA replicates itself or makes copies before taking part in…

Q: Give typing answer with explanation and conclusion With an example explain how SNPs may and may not…

A: SNPs are variations in the DNA sequence that occur when a single nucleotide differs between…

Q: Match the microbial function(s) with the most appropriate nutrient type.

A: The term "Microorganisms" can be split up into two words "micro" which means relatively small and…

Q: The first three codons for a mRNA sequence are 5' CCG GCC UCA 3'. What anticodons will the correct…

A: The DNA encodes for protein molecules, carrying out all the functions necessary for life. Enzymes…

Q: neisseria gonorrhoeae attached to the mucosal epithelium and causes infection by phagocytosis lysis…

A: Neisseria gonorrhoeae, the bacterium responsible for gonorrhea, initiates infection by interacting…

Q: Given the following sequence of mRNA, choose which tRNA will be next to incorporate: UAC…

A: The production of protein or polypeptide chain by using the mRNA codon is known as translation that…

Q: Test that Mode of Inheritance is Sex Linked Recessive for experiments at each of two research…

A: If the mode of inheritance is sex linked recessive as in the above question then female carrying the…

Q: Discuss how viruses are inhibited by interferons and how some viruses have evolved resistance to…

A: An infectious microbe which consists of…

Q: Question 5 Use the following diagram to answer questions 4 and 5: Chose the appropriate letter. 14N…

A: Production of new DNA from the old DNA is known as DNA replication. In case of eukaryotic cells DNA…

Q: Which of the following is an example of bioremediation? using a bulldozer to regrade a strip mine…

A: Bioremediation is the use of living organisms, such as bacteria, fungi, or plants, to break down or…

Q: 10. Two individual plants (A and B) have the following sets of replicated chromosomes (see figure).…

A: Genetic variations are important for the evolution and diversity of species. These variations can…

Q: 1.Identify the labeled structure responsible for transmitting signals to other neurons or target…

A: We can clearly see here- axon, dendron and the cell body. Also, there are node of Ranvier, myelin…

Q: Examining the following peptide sequence, it is determined to be phosphorylated. -WQRYGLK- Which…

A: Amino acids are made up of carbon, hydrogen, oxygen, and nitrogen. The standard amino acids are…

Q: What is this formula and how is it derived?? This was used in an experiment related to the screening…

A: Various analytical techniques are used to examine the amounts of carotenoids in biological…

Q: question: A sustained decrease in MAP could result in decreased release of ACh by preganglionic…

A: This investigation looks at how a persistent drop in mean arterial pressure (MAP) affects the…

Q: Please provide ingredients and steps on how to make DRIED MANGOES Note: please refer to the given…

A: Dried mangoes are a delicious and nutritious snack enjoyed by numerous. They are made by removing…

Q: Write in a unique derived trait for: A1: strepsirrhines (lemur/loris/potto/bushbaby) A2: tarsiers…

A: A complicated and intriguing subject that spans millions of years is the evolution of monkeys.…

Q: One day while walking across campus, you see a female butterfly laying fertilized eggs, as shown in…

A: In this scenario, we are presented with a female butterfly laying fertilized eggs on a leaf.  Each…

Q: Culture Change

A: The above statement explains about Cultural and inequality.

Q: Consider a genome whose length is 1000 bp. "Shotgun" sequencing techniques are applied to the…

A: Shotgun sequencing is an important tool in modern genomics that allows researchers to interpret the…

Q: From a kinetics experiment, Kcat was determined to be 55sec^-1. For the kinetic assay, 0.05mL of a…

A: When the enzyme is saturated with a given substrate then the maximum rate of enzymatic reaction is…

Q: 6. A cell that has a fully replicated genome with no DNA damage will enter which phase? A. The G₁…

A: The cell cycle is an intricately regulated process that controls how quickly and how many times…

Q: Most proteins found in mitochondria are synthesized in  a. the mitochondrial matrix  b. the…

A: The cell is the basic unit of all biological entities. It contains various sub-cellular structures…

Q: A cloned Bam HI DNA fragment, 3.0 kb long, was isolated in preparation for sequence determination.…

A: Restriction mapping is done by analysing and arranging the fragments that are generated by the use…

Q: LO21 Calculate genotypes and phenotypes in sex-linked, sex-limited and sex- influenced traits The…

A: The presence of beard on some goat is determined by autosomal gene and it is dominant in males and…

Q: High altitude is an example of what type of stress that requires adaptation on the part of the…

A: In a challenging environment, adaptation towards stress plays an important role in survival in…

Q: Diffusion experiments of a small molecule drug in tissue samples are performed. The drug has a…

A: The ability of a dug to diffuse through the cell membrane is called diffusivity. Lipophilic drugs…