First program (server.cpp): 1. Creates a shared memory segment for store three integers' numbers (number1, number2 and number3). 2 Lauquena sagala 0039+04+ 20400 0420311 09+ +wong poacys 04+ ! Cauquan puc caoquana
Q: You could pick the waterfall approach over a more modern one. Choose a contemporary flexible…
A: The conventional waterfall method can be the best option for you if your project has well defined…
Q: server OSes?
A: The two most popular server operating systems (OSes) are Microsoft Windows Server and Linux. Both…
Q: Which of the following typically carries the most capacity: a. secondary storage b. primary storage…
A: Storage in computer science is the act of putting digital information on a physical or electronic…
Q: I would appreciate it if you could explain why creating a challenge-response authentication…
A: Authentication is an essential component in the field of cybersecurity, serving to guard against…
Q: Understanding will be aided by drawing the project's map both with and without its core…
A: Before starting a project, determine its objectives. This information necessitates breaking the…
Q: Consider your project in light of the article's example and decide whether waterfall is right for…
A: The Waterfall technique, a type of project management, is frequently used to oversee the software…
Q: Write a program that reads movie data from a CSV (comma separated values) file and output the data…
A: Coded using C++
Q: What makes CentOS unique?
A: CentOS is an open-source and free operating system based on Red Hat Enterprise Linux (RHEL). It is…
Q: Why is it more probable that the content of an email may be misconstrued, and what factors…
A: Dear learner, hope you are doing well. I will try my best to answer this question. Thank You!!
Q: how to explains in detail about Human Machine-Computer interaction for below example?
A: Human Machine - Computer interaction means the human interacting with the computer in various ways…
Q: H.W: Develop a program that will cause output D to be on when push button A is on, either B or C are…
A: The objective of this programming task is to create a program that will control an electric motor…
Q: I would appreciate it if you could cite two instances of arguments that have taken place between…
A: The field of computers is vast and continuously evolving, with new technologies, trends, and issues…
Q: Comprehending the project better may be accomplished by drawing its map with and without the…
A: Creating a project map can be a useful way to visualize and understand the various components of a…
Q: Identify web-using industries and the issues they face throughout development, testing, and…
A: Web engineering is the process of creating, managing, and improving Web-based systems via the use of…
Q: In addition to listing the services that operating systems provide, you should also list the three…
A: Operating systems are the foundation of contemporary computers and provide consumers a broad variety…
Q: Share software development metrics. Everything must be detailed.
A: Software development metrics are measurements that quantify different aspects of the software…
Q: When it comes to the software that runs on computers, what are the most significant differences that…
A: Computer operating systems are usually divided into real-time as well as non-real-time varieties in…
Q: Write a program that implements a double linked list. The MyLinked List class used in Listing 24.5…
A: Linked list The most popular data structure for processing elements of dynamic data is a linked…
Q: Explain the many processes involved in acquiring software, including the production of traditional…
A: Software acquisition entails a number of steps, from determining the software needs to choosing and…
Q: How may internet tools improve health? What makes telesurgery different from telemedicine?
A: By providing access to medical information and resources, online resources can boost health in…
Q: Exists a certain system type that adapts to agile development approaches especially well?
A: Agile development methodologies are intended to be adaptable, flexible, and iterative. As a result,…
Q: Explain how to get traditional and web-based software, as well as other possibilities.
A: Explain how to get traditional and web-based software, as well as other possibilities.
Q: List distributed system hardware requirements.
A: distributed system hardware requirements has been given below
Q: In this section, you will find an explanation of the idea of a computer's environment, as well as an…
A: A computer's environment is the combination of its hardware, software, and other components that…
Q: Think about your own project in the context of the one that the article uses as an example, and then…
A: The answer is given below step.
Q: JavaScript that asks the user to enter 3 integers and find the largest
A: In this problem, we want to create a JavaScript program that prompts the user to input three…
Q: How should Web application components communicate data?
A: A web application is any piece of software that is hosted on a web server and accessible through a…
Q: Can you hep me create three different classes in C++ in the following question? (Important: Do not…
A: The program reads a file containing information about sensors placed along a racecourse. The sensors…
Q: Distributed systems share software components. It implies?
A: 1) A distributed system is a software architecture that consists of multiple nodes or computers that…
Q: Email providers may encounter issues while reviewing consumer messages.
A: Email providers may encounter various issues while reviewing consumer messages, particularly those…
Q: Write the program code that compares the data at the address that will come over P1 with the data at…
A: We have to create program code that compares the data at the address that will come over P1 with the…
Q: IT pros worry about email encryption ethics?
A: Email encryption: It is an authentication process that prevents messages from being read by an…
Q: Denial of service attacks may harm traditional email. Will you use this information to defend…
A: We need to understand and investigate the many ways that a denial of service attack may endanger…
Q: Does a certain system type that adapts to agile development approaches especially well?
A: What is Software developement: Software development refers to the process of designing, creating,…
Q: Repeat Problem 5 with the following matrices A and b: a₁j = aj1 = ß, A¡j = Ai−1,j +A¡‚j−1, b¡ =…
A: Hello student Greetings Hope you are doing great. Thank you!!! The solution for question 6 is…
Q: Make sure you are well-prepared in case of an unexpected event. Where do mobile backup solutions…
A: Mobile backup solutions diverge from conventional PC backup techniques in terms of limited storage…
Q: Email service providers accessing client emails has what drawbacks?
A: Emails are digital messages exchanged and received via computer networks. Email is short for…
Q: How should Web application components communicate data?
A: In order to deliver a seamless user experience, Web application components are developed to…
Q: You have a fundamental comprehension of the use of social networking sites. What are the benefits…
A: The ability of a system or application to function autonomously and make decisions without human…
Q: Understanding will be aided by drawing the project's map both with and without its core…
A: Creating a project map Before beginning an undertaking, it is essential to understand its…
Q: Can the Internet help programmes in many ways? These services vary significantly.
A: The world of programming has recently been significantly impacted through the internet, which has…
Q: By using the DJNZ command and indirect addressing, create the data given below to the addresses…
A: The 8051 microcontroller is an 8-bit microcontroller designed in 1980 by Intel for use in embedded…
Q: Create an expansion of the structure. MyVector is a new vector that has the sort technique. The…
A: Here's an expanded version of the steps: Define a new class called MyVector as an extension of the…
Q: Despite the fact that Windows 10 may be backed up using a variety of different approaches, what are…
A: Key Benefits Taking regular backups of your Windows 10 system may bring a number of important…
Q: How can I make a backup of my computer running Windows 10, and what are the primary advantages of…
A: A Windows 10 PC may be backed up in a variety of methods, including the following: Utilizing the…
Q: You're social media-savvy. Autonomous cloud computing? Examples show this. Weblogs and cloud…
A: Social media platforms rely heavily on cloud computing to provide users with fast, reliable, and…
Q: Provide an illustration of how a distributed system could profit from shared software resources.…
A: In this question we have to provide an illustration of how a distributed system could profit from…
Q: Explain several methods for getting software, such as offline and online software development…
A: While online software requires an internet connection, offline software does not. Offline software…
Q: how to explains in detail about Software engineer from the beginning for below example?
A: Software engineer is a person who done software engineering which is a study of engineering to…
Q: In a distributed system, the individual nodes share several software components with one another.…
A: Within a distributed system, numerous nodes collaborate to complete a single job. These nodes could…
Answer the given question with a proper explanation and step-by-step solution.
Please answer correctly according to the question
Step by step
Solved in 3 steps
- Please write a c++ program that will take in a file, a number_of_bytes and number_of_threads. So it will take in 3 arguments in the command line. mmap the number_of_bytes of the given file into memory. The program will mmap 100 Megabyte of file into memory and use 4 threads to examine the bytes. The main will not participate in the computation, but will create the specified number of threads, and wait for them to complete the computation, and the main will then print the answer. At most 8 threads will be specified to be created. Each file will contain a long string of letters like DNA, i.e. a,c,g,t The program should determine how many 20-character substrings contain more than 11 a's. For example, in this string there are characters matches: tattataaagtagaaatataactgaaggttcagccgctggattataaagtagaaatataaaaagtagaaatataactgaa The program should output: total matches number # number is replaced by the correct numberWrite code in C language. Create an integer array as input in C programming language. Create two threads. The first thread sums the even elements of the array, and the second thread sums the odd elements of the array. You can declare only one function outside the main functionExercise 2:Write a Java program that allows the user to specify a file name on the command line and prints the number of characters, words, lines, average number of words per line, and average number of characters per word in that file. If the user does not specify any file name, then prompt the user for the name.
- The following question is related to Threading in C programming Task-3: Write a program in c that has a function that takes the name of the user and adds all the ASCII value of the characters and returns it. Now create 3 threads that run the function using 3 different user names. Now print “Youreka” if all the returned values are equal, print “Miracle” if the 2 returned values are equal, and print “Hasta la vista” if the values don’t match using another thread.Exercise 2: Write a Java program that allows the user to specify a file name on the command line and prints the number of characters, words, lines, average number of words per line, and average number of characters per word in that file. If the user does not specify any file name, then prompt the user for the name.Write a C++ program to create C++ menu driven programs on LIBRARY MANAGEMENT SYSTEM has book and student class with data members like book no, bookname, authorname. Books records is stored in a binary file. A student can issue book and deposit it within 15 days. Student is allowed to issue only one book. Student Records are stored in binary file. Administrator can add, modify or delete record.In this project, do not used graphics to keep program simple.
- Write a C program that gets a source file name from a user. If the file does not exist, it will generate a proper error and exits.If the file exists, it also gets the name of two more files from the user, say destination1 and destination2. These files don’t need to exist as they are files that need to be written to. If the files cannot be opened for writing, a proper error will be generated. The program then reads the source file line by line. It will copy every line that has a digit in it to destination 2 and lines that have no digit in them to destination 1. Feel free to use ctype’s isdigit() function to identify digit characters. Example: If source file is:Hi My name is VeriaHello My name is John. How can I help you?I have a problem with my giga bit internet. The speed should be around 1000 but it’s just 200 Sure! I can help with that. Can I have your number in case we get disconnected? Sure! My number’s 647-123-1234 First file (destination 1) should be Hi My name is Veria Hello…Write a C program that performs the following tasks 1. The program should create three child processes. 2. Each child process should display its PID and the parent PID 3. The first child should display all the numbers from 1 to 100. 4. The second child should display all the content of the source file on the screen. 5. The third child should take two 2x2 arrays as an input and display their sum. 6. The main program should display the message "All child processes have completed" and then exit. 7 Ensure that the all the chiled processes complete their execution before the main program quits.d. Interface Find the number of addressess in the range if the first address is 14.7.24.0 and the last address is 14.7.27.255 Select one: a. 1024 O b. 2048 C. 512 d. 256 ch01 - Search Resul... search
- In C++, not C please! Assume that your computer has 4 CPUs. Write a multithreaded program that runs 4 different threads concurrently. The entire process will add the first 1,000,000 numbers (from 1 to 1,000,000) to a shared variable sum. You need to use a pthread_mutex_t to provide mutual exclusion so that the final result of sum is 500,000,500,000 Note: you can download and modify the file summation_thread_shared_sum.cpp. This file does not use a mutex lock, so the result is incorrect. You must add a mutex lock correctly in the file so that the program generates the right outcome.Need help to implement networking in python Server.py Load data from file This option will ask the user for a fully qualified path and will load a JSON file containing the information for users and pending messages. The format of the JSON file will be defined based on your implementation and it will the same used to save the data into file (menu option #4). Functionalities the server must provide: 1) User Sign Up: adds a user identified by a phone number to the system. a) Protocol: USR|username|password|display_name b) Response: 0|OK for success. 1| for an error. c) The server should validate that the username does not exist 2) User Sign In: verify user credentials a) Protocol: LOG|username|password b) Response: i) 0|OK → the credentials are correct. ii) 1|Invalid Credentials iii) 2|Already Logged In → in case that the user is logged in from another client. c) This will help the server knowing which user is connected. d) The server should keep a list of connected clients, which should…Can you please help me with this code because I am struggling on how to do this, This has to be in C code. question that I need help with: Write a multithreaded program that calculates various statistical values for a list of numbers. This program will be passed a series of numbers on the command line and will then create three separate worker threads. One thread will determine the average of the numbers, the second will determine the maximum value, and the third will determine the minimum value. For example, suppose your program is passed the integers 90 81 78 95 79 72 85 The program will report The average value is 82 The minimum value is 72 The maximum value is 95 The variables representing the average, minimum, and maximum values will be stored globally. The worker threads will set these values, and the parent thread will output the values once the workers have exited. (We could obviously expand this program by creating additional threads that determine other statistical values,…