Figure 1. A representation of remdesivir and the viral replication machinery for SARS-CoV-2. 6. Figure 1 shows that remdesivir "mimics" an important component of RNA replication. Which component o Adenosine RNA replication has a structure similar to that of remdesivir? . Propose a hypothesis about how remdesivir might inhibit the virus's replication process.
Q: Describe how viruses replicate. Be sure to address the difference between lytic and lysogenic…
A: Viruses are microscopic infectious agent which consists of nucleic acid molecule in a protein coat.…
Q: Why can a virus multiply?
A: A virus can be defined as a small collection of genetic codes. The genetic material can either be…
Q: RNA viruses need to regulate the switch from mRNA synthesis to genome replication. Describe three of…
A: Introduction :- RNA Viruses contains RNA as their genetic material . It can be single-stranded RNA…
Q: Which is the usual order of a viral replication cycle when it is making new virions? O Host…
A: Viruses are the obligate parasite. They require host cell to complete their cycle from the…
Q: Give a short discussion of the lytic and lysogenic phases in the lifecycle of certain viruses. the…
A: Bacterial viruses called bacteriophages can undergo two types of life cycles - lytic or lysogenic.…
Q: Stress can cause a latent virus to enter the lytic cycle, resulting in symptoms for the host. A.…
A: Virus is non - cellular particle which is smaller than the bacteria. They act as alive when enter…
Q: irus has a double-stranded RNA genome that has 2400 base-pairs. Of these, 35 % are G:C base-pairs.…
A: A single nucleotide is made up of three parts : Pentose Sugar : ribose in RNA( Ribonucleic acid) ,…
Q: Let's imagine you have discovered a new RNA virus and found a cell line to grow the viruses (lucky…
A: Answer of the question given below...
Q: There are five stages in viral replication, name them and describe what is happening in each stage.
A: Introduction :- A virus is a small piece of genetic material, such as DNA or RNA, encased in a…
Q: After consulting table , what additional facts can you stateabout viruses, especially as compared…
A: Virus is an ultramicroscopic entity which becomes active only inside a living cell using host’s…
Q: Describe the replication cycle of retrovirus like HIV (human immunodeficiency virus) Be sure to…
A: Retroviruses are different from other viruses because they contain the reverse transcriptase enzyme,…
Q: Syn5 is a virus that infects photosynthetic bacteria belonging to the genus Synechococcus. The Syn5…
A: Syn5 is a double-stranded cyanophage characterized by a short tail. It is isolated from the Sargasso…
Q: Include the steps in the correct order from attachment to lysis.
A: (Note: You have add multiple question, I am sorry but I can able to answer only one question at a…
Q: Influenza is an RNA virus. Does it encode for its own polymerase for genome replication? - yes…
A: The influenza virus is known to cause the condition influenza (commonly called flu). A, B, C, and D…
Q: Viruses replicate by entering a cell and using the host cell's enzymes to produce more copies of…
A: 1- Volume of sphere- 4/3πr3 2- Volume of cylinder= πr2 h Diameter= 2r Here: π=3.14 r=radius of…
Q: The cell is the basic unit of all living things, and viruses which are generally not considered…
A: The process of discriminating between various biological structures aid in understanding the…
Q: while viruses are considered by most scientists to be nonliving they do show some characteristics of…
A: Answer: VIRUS = It is a microscopic non-living agent which has protein coat and genetic material but…
Q: Viruses with negative sense RNA genomes typically, make proteins by: (Ignore retroviruses, and the…
A: Ans- Since the viral genome is of negative sense so it can't be translated directly into proteins.…
Q: a typical eukarytic cell has a diameter of 50 microns while a corona virus particles has a diameter…
A: Given that the diameter of a typical eukaryotic cell = 50 microns the diameter of a coronavirus…
Q: Chemical composition analysis of a viral genome showed 22.1% A, 27.9% C, 27.9% G, and 22.1% U. Based…
A: Given base composition is: Adenine = 22.1% Cytosine = 27.9% Guanine = 27.9% Thymine = 22.1 %
Q: Briefly explain why all viruses with a RNA genome (excluding retroviruses) must produce their own…
A: RNA polymerase is a protein that converts DNA sequences into RNA and then synthesizes new strands of…
Q: What does circulating HBeAg indicate about individuals with chronic HBV infection?
A: Introduction: The HBeAg stands for hepatitis B e-antigen. This antigen circulates in the blood of an…
Q: You wish to produce a subunit vaccine for a nonenveloped positive‐sense RNA virus that will…
A: * There are two kinds of viruses based on presence of outer layer Enveloped virus Non enveloped…
Q: What part of the virus carries the instructions for making viral particles? plasmid envelope O…
A: A complete virus particle is formed of the genetic material enclosed in a protein coat called a…
Q: The new varients of the COVID virus infect cells more easily than the original. What key changes in…
A: Changes that could take place in the spike protein could cause the formation of new variants of the…
Q: The rabies virus is a negative strand single stranded RNA virus, simply referred to as (-) ssRNA.…
A: Rabies virus (Rabies lyssavirus in technical terms) is a neurotropic virus that causes rabies in…
Q: what are the chemical composition of a virus and structures that make up a naked and an enveloped…
A: Viruses are the sub-microscopic organisms, also known as the boundary line between living and…
Q: 1. When SARS-CoV-2 replicates in cells, mutations can occur in the virus's genome. Explain how a…
A: A mutation is a DNA alteration effecting the protein it encodes.
Q: properties of virus particles
A:
Q: What are 3 components of a SARS-CoV-2 virus particle that must be present in order for the viral…
A: Coronavirus illness 19 is caused by a virus that produces a respiratory ailment (COVID-19).…
Q: Of all the characteristics of viruses (types of capsids, viral nucleic acid, and viral genome),…
A: Viruses are ultramicroscopic, disease producing obligate intracellular parasites, i.e. Can not…
Q: briefly state the importance of each stage of viral replication. Do not just restate what each stage…
A: The process by which viruses are formed in host cells during the infection process is known as viral…
Q: Describe the process of replication of a Lytic phage and a Lysogenic phage. In your answer you must…
A: Introduction A replicon is the whole segment of Dna that is replicated independently from a single…
Q: The protein covering the central nucleic acid core of a virus. Protein coat of the HIV virus.
A: All the viruses are composed of a nucleic acid genome, sheath, a protein capsid, a tail fiber and a…
Q: Charged spherical viruses have polymer chains attached to their surfaces, e.g. they are ‘PEGelated’…
A: Polymers that present at surfaces can provide steric entropic forces as a result of the…
Q: In some viruses, capsomeres function as enzymes as well as structural supports. Of what advantage is…
A: Viral capsids are nanometre-sized containers that possess complex mechanical properties and main…
Q: 4. Illustrated below is the parts of SARS-CoV-2 virus. Search for the FUNCTIONS of the ff…
A: Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-CoV-2) is a RNA virus belongs to the family…
Q: 17. Animal viruses: Describe the replication cycle of a retrovirus like HIV (Human immunodeficiency…
A: Retroviruses are different from other viruses because they contain the reverse transcriptase…
Q: Define and describe prions, including their replication process and contrast them with viruses.
A: A prion is a type of protein that can trigger normal proteins in the brain to fold abnormally. Prion…
Q: DNA from a newly discovered virus was purified, and UV light absorption was followed as the molecule…
A: An increase in the absorbance is termed as hyperchromicity effect. The absorbance is checked at 260…
Q: Of all the double-stranded DNA animal viruses, poxviruses stand out concerning one unique aspect of…
A: Viruses are omnipresent. They are living inside the cell and they are non-living outside the cell.…
Q: Number the following stages in viral replication from 1 to 5 to show the correct order: replication…
A: Introduction The production of biological viruses throughout the infection process in the target…
Q: Given this information, how might we be able to distinguish the SARS-CoV-2 strain from some of the…
A: The virus is a novel kind of Covid. This is a group of germs that normally causes colds. Be that as…
Q: Given that viruses must be cultivated to make vaccines against viral diseases, discuss the…
A: Viruses are generally non-cellular organisms that are composed of genetic material and protein. The…
Q: Tat and Rev proteins are required for HIV replication. What are their roles and why are they…
A: Introduction Human immunodeficiency viruses (HIV) are two types of Lentivirus (a type of retrovirus…
Q: Identify the numbered steps of this viral life cycle/replication cycle depicted here
A: The lysogenic and lytic cycles are the two stages of viral replication. Bacteriophages T4 Phage may…
Q: 2. Predict the replication step for the novel Miovirus. This virus was determined to have a dsRNA…
A: [Double-stranded RNA viruses ]dsRNA viruses Polyphyletic category of viruses Has ribonucleic acid…
Q: How can DNA/RNA viruses trigger cancer by inserting into infected cells chromosomes for a particular…
A: The ability of viruses causing tumors were discovered first by Peyton Rous. He removed a tumor from…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Predict the replication step for the novel Miovirus. This virus was determined to have a dsRNA genome Draw out your prediction. Include any proteins/enzymes the virus will need to use, bring or express to carry out the replication. Indicate where it is likely for replication to occur in the host cell.Within the long-terminal repeat in the retrovirus genome is a PBS. If the PBS was mutated such that the molecule could no longer bind, what consequence would this have on the retrovirus life-cycle? Explain your answer. TTTT Paragraph Arial v a (12pt) E- E. T OIX8Alternative splicing Template strand S F yIGUide1,mq00:c-00: Replisome Transforming principle Origin of replication (or)eleb al msxS ain Coding strand Transcription factors Leading strand Single nucleotide polymorphism Okazaki fragment Telomerase M Nucleoside RNA Polymerase I RNA Polymerase II RNA Polymerase IIIon & of qu 9ven UoY Insertion mutagenesis Spliceosome Transcription Unit SNP Reverse transcriptase 1 Seminal work by Oswald Avery and colleagues demonstrated that DNA is what Frederick Griffiths called this etniog OS dotsM bioW 1-2kb of newly synthesized DNA strands are called this ainiog PS Assembly of the replisome is an orderly process that begins at these precise sites Snoiteeu 4 Transcribes ribosomal RNA genes in eukaryotes 5. A large nucleoprotein complex that coordinates activity at the replication fork Single base pair differences between homologous genomic regions isolated from different members of a population Complex of proteins and snRNAs catalyzing the removal of…
- 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the nucleus b. IF they have nuclear localization sequence they will go to the nucleus c. The nuclear localization sequence can be either simple or bipartite of conserved leucine d. If the viral protein is made by free ribosome, most likely it will go to the surface of the ot the cell.40 Shown below is the antisense strand of DNA. What is the amino acid sequence that corresponds to this code? 5' AAAGCATACCGG 3' Second letter G. UUU Phe UCU UAU) Tyr UGC Cys UGU UUC UCC UAC Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUA UCA UUG Leu UG CAU His CGU CGC CGA CGG CU CUU CUC CUA CUG CAC Pro Leu Arg CCA CAA) Gin CCG CAG AAU AUU AUC lle AUA AUG Met ACG ACU AGU AAC Asn AGC Ser ACC ACA Thr AAA1 AGA AAG Lys AGG Arg GAU) Asp GGC GAC Ala GAA GGU GUU GUC GUA Val GCU GCC Gly GCA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a PRO-VAL-SER-PHE PHE-ARG-MET-ALA GLY-HIS THR-LYS d LYS-ALA-TYR-ARG First letter Third letterReplication of many RNA viruses depends on RNA polymerase. The antiviral drug ribavirin does not inhibit the polymerase but instead increases its error rate. Explain how this affects the virus.
- EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .In not more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus48 Second letter If any single nucleotide is deleted from the DNA sequence shown below, what type of mutation is this? UUU U UUC UUA UCU Phe UCC UAU UGU Cys ANTISENSE 5' GGACCCTAT3' UAC Tyr UGC UAA Stop UGA Stop UAG Stop UGG Trp Ser UCA Leu UUGL" UCG CUU CU CAU) His CAC) CGU CGC CGA Arg CUC C Leu Pro CAA1 Gin CAG) CUA CCA CUG CG CGG AAU AAC Asn AGC AAA AAG Lys AGG Arg AUU ACU AGU Ser AUC lle ACC Thr AUA ACA AGA AUG Met ACG GCU GCC GUU GAU] GGU GUC Val GAC Asp GGC Ala Gly GUA GCA GAA GGA Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a FRAMESHIFT SILENT NONSENSE MISSENSE Third letter First letter
- 1. "One structural form used in building virus particles is based on the icosahedron. Describe, either in words or in a diagram, the organization (number of capsomers, etc.) of the simplest virus particle of this form. 2. If a virus has a negative‐sense RNA genome, what enzymatic activity (if any) will be found as part of the virion, and what will be the first step in expression of the viral genome?"You are working in a research lab studying human Peptide Z, which is a short protein that plays a key role in responding to SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but she neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3'-TCT GGG TẠC GGA GTC GTC AAG AAA CCT AAT TẠC ATT-5' Using your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand is the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) What is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. 5' - - 3' What is the amino acid sequence of Peptide Z? Make sure you indicate the carboxyl-terminus and amino-terminus with C and N, respectively.OF rasc PDF Teas fill Which of the following is NOT a step in the replication of a retrovirus? A diagram illustrating the process is provided below. PDF UNOFFIC TRANSCR 59°F Mostly cloudy Virus Viral RNA Reverse transcriptase DDDDDD ↓Viral DNA Provirus mRNA mm Proteins mn Viral RNA Protease Plasma membrane Host DNA New virus O The single-stranded DNA forms a double-stranded DNA called a provirus, which is incorporated into the host cell DNA. O After a retrovirus attaches to the host cell, it injects its viral DNA and uses the host cell's machinery and materials to replicate. O After a retrovirus injects its viral RNA into a host cell, it forms a DNA strand by reverse transcription. O When the host cell replicates, a provirus produces the viral RNA needed to produce more virus particles. P O Search hun recc PDF maste omiss