Q: 17. Which of the following is the CORRECT base pairings in RNA? * A. Uracil and Adenine B. Thymine…
A: Introduction :- A base pair is a basic unit of double-stranded nucleic acids, consisting of two…
Q: 19. Which class of carbohydrates consist of two monosaccharides that are covalently bond with one…
A: Carbohydrates, also known as sugar molecules, are sugar molecules. Carbohydrates are one of three…
Q: Use the following figure to answer the question. юдо TO The pedigree in the figure shows the…
A: A pedigree chart is a graphic which depicts the incidence and emergence of phenotypes of a specific…
Q: What is ecosystem? What are the various components of ecosystem.
A: Environment: The sum of the weather, factors, and conditions in the environment that have an impact…
Q: Adenosine Triphosphate (ATP) is the energy currency of the cell in any metabolic activity of the…
A: Adenosine triphosphate (ATP) is a three-phosphate nucleotide. The addition of phosphorous to the…
Q: Q11-The internal sphincter control for flow of urin is
A: Urine is a liquid by-product. Urine flows from the kidneys through the ureters to the urinary…
Q: What is the only known effect of deficiencies in complement components C5–C9? Explain this effect.
A: Introduction: The innate humoral immune system relies heavily on the complement system. The…
Q: Match the water soluble vitamin with its main function. coenzyme specifically with tryptophan…
A: Introduction A vitamin is an organic substance that is a necessary micronutrient that an organism…
Q: 27 28 26 25 29. 30. 24 31 23 32 22 33 34 20 P -w² 19 8 15 16 72hr chicken embr Transverse section…
A: Embryology is the branch of biology that studies embryogenesis, or the formation of an embryo out of…
Q: Two mice with gray fur are crossed. They produce 15 gray, 8 black, and 6 white offspring. In one…
A: Introduction: An organism's phenotype refers to its physical characteristics or appearance. The set…
Q: To describe the life cycle of the typical bread molds.
A: The zygomycetes are a relatively small group in the fungi kingdom and belong to the Phylum…
Q: The Gram staining technique is useful to classify Bacteria. Can the technique be applied to Archaea?…
A: Introduction: While peptidoglycan is found in most bacterial cell walls, not all bacterial cell…
Q: What is the average radius of a piece of double-stranded DNA in water that has a link length of 5.9…
A: f the link length of the double stranded DNA is 5.9nm so the complete length would be 17813445.2 nm…
Q: Summarize the steps in generating an action potential as a flowchart. You can make your flowchart on…
A: Action potential occurs when the already negative potential inside the membrane becomes positive.…
Q: why is the bending of the double helix to form a superhelix falls into the area ofgeometry or…
A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…
Q: If jaguar populations become isolated, would this be enough to classify them as subspecies?
A: Jaguar considered as keystone species that means, they are the apex predators which helps in keeping…
Q: Predict which one of the following organisms will have the highest percentage of unsaturated…
A: Introduction :- Each phospholipid is made up of two long chains of atoms known as fatty acids. There…
Q: Query Sequence A 0 Database Sequence B 10 0 5 Match 1 30 35 38 25 40 30 33 Match 2 Mismatch Match 50
A: Sequence alignment refers to the arrangement of the DNA/RNA/protein sequences to find out the…
Q: Answer the following about low carbohydrate diets: true/false Is made up of a large about of nonfat…
A: 1) A low carbohydrate diet is the one which includes the food items that contains a low amount of…
Q: Which of the patterns below is not an MII pattern? A в с D
A: In some fungi, product of meiosis is four spores or eight spores.
Q: basis for characterizing species under order pseudophyllidea
A:
Q: Consider a 12-carbon saturated fatty acid, calculate the following: a. number of acetyl CoA b.…
A: Catabolism of fatty acids includes three steps - 1. Activation of fatty acid 2. Beta oxidation 3.…
Q: Contains a bait molecule which sequesters and inactivates microbial proteases. Small protein…
A: Defensins, pentatraxins, bradykinin, psoriasis and alpha2 macroglobulin are molecules which have…
Q: Normal cells grow and divide faster than of the cancer cells True False O O
A:
Q: 1. Compounds with the same molecular formulas like glucose and fructose are called ______________.…
A: Glucose and fructose are simple sugars. Sucrose is a disaccharide made of glucose and fructose.
Q: How does genetic analyses of fossils help us understand human evolution better than just examining…
A: following is description of how genetic analysis of fossils help understanding human evolution…
Q: Which of the following not a characteristic of immur secondary response? ○ IgG isotype ○ No lag…
A: This is the subsequent immune response after the primary immune response, also known as the…
Q: Explain structural adaptations necessary for the invasion of dry plants and also state which…
A: To survive against the drought conditions various plants undergo structural modifications. Some of…
Q: A transmembrane protein has the following properties: it has two binding sites, one for solute A and…
A: Introduction :- Transmembrane proteins (TP) are integral membrane proteins that traverse the entire…
Q: Answer the questions in the frame below. 1. What organ(structure) is shown in the figure? 2. What is…
A: Introduction The liver is the body's largest solid organ as well as the largest gland. It performs…
Q: choose a product of nanotechnology found at home. Discuss the purpose and how the technology is…
A: Nanotechnology essentially means employing the matter at a tiny scale, at the atomic and molecular…
Q: If you were able to watch a ribosome move along a mRNA by one codon, which of the following would…
A: Translation: The process through which RNA codes for specific proteins is known as translation. It…
Q: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals have…
A: Given: Phenylketonuria (PKU) is a disorder caused by a recessive allele. Two carrier individuals…
Q: What type of features do you feel should be used to classify humans as a species?
A:
Q: Answer the questions in the frame below. 1. What organ(structure) is shown in the figure? 2. What is…
A: The development of various organs in the embryonic stage is a time-bound and complex process.…
Q: Should one line of evidence hold more weight than another when we discuss the classification of…
A: Classification of species has made it possible to group species of plants, animals and…
Q: How do HIV criminalization laws conflict with the medical evidence on how HIV is spread. In the…
A: The human immunodeficiency virus (HIV) is an infection that targets the immune system, primarily CD4…
Q: Create a metabolic pathway map that includes "the 4 Gs": glycolysis, gluconeogenesis, glycogen…
A: Glycolysis is The process by which glucose is converted into pyruvate. Gluconeogenesis is the…
Q: Below is a partial pedigree of hemophilia in the British Royal Family descended from Queen Victoria,…
A: Introduction :- Hemophilia is a bleeding ailment that is passed down down the generations. Blood…
Q: Critics of evolution often cite the fact that several hypotheses are being tested to help explain…
A: Introduction Evolution is the process of a species' features changing over numerous generations…
Q: Some modern ethnic groups (white Europeans and Asians) have apparently inherited genes from…
A: Introduction Studies found that modern human has been influenced by past species. Scientists found…
Q: How might you use biotechnology to show humans today have Neanderthal genes, and therefore,…
A: Biotechnology is the use of living organisms to create or modify products, or to perform processes…
Q: DRAW the set-up for mounting and labeling of stained tissue section.
A: A cover slip must be placed over histological sections that will be analyzed or stored for an…
Q: Identify and label the parts of the following specimens of Phylum Platyhelminthes:
A: It is critical to learn and know the anatomy and physiology of the body. Many changes in the animal…
Q: Discuss how excess carbon dioxide lead to a mass extinction in the Permian period.
A: A mass extinction event is when species disappear a lot quicker than they are replaced. This is…
Q: Q2- The charge in nerve axon depending on-------inside axon, ----outside axon Na, K OK,Na k,CL
A: In neuron , Positively charged Na+ ion is pumped out and positively chared K+ ion is pumped…
Q: You have cloned a novel E. coli gene and wish to express protein from it in human cells. In order to…
A: The Central Dogma theory explains that DNA forms DNA by Replication, DNA forms RNA by Transcription…
Q: In table 21.1, the effects of injection of different types of RNA into wild type mice was examined.…
A: miRNA(micro RNA) is type of non coding, single strand RNA. It involves in gene silencing and…
Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…
A: DNA is a double helical structure composed of two DNA strands.
Q: What innate physical & chemical barriers normally work together in the mucus membrane to fend off…
A: Introduction: In all multicellular organisms, the innate immune response was the first host defence…
Step by step
Solved in 2 steps with 1 images
- Describe the Prokaryotic genome structure and size (1000 words).Describe two main reasons why the proteomes of eukaryotes are usuallymuch larger than their genomes.i)Describe a strategy for regulation of transcription in eukaryotes. ii)Explain how this strategy is different than what might be used by a prokaryote.
- Describe rho independent termination in prokaryotesDescribe the hypothesized steps in the origin of eukaryotic cells.Ch 27 – Prokaryotes – Bacteria and Archaea Difference between prokaryotes and eukaryotes. List the internal and external cellular parts of a bacterium. Describe Gram staining and differences between Gram + and – bacteria. Describe prokaryote reproduction. What are the sources of genetic variation in prokaryotes? In a table format compare similarities and differences between transformation, transduction and conjugation. List the different modes of prokaryote nutrition. What is the significance of oxygen and nitrogen for prokaryotes. List the types of archaea and where can you find archaea? List examples of prokaryotes of ecological, economic and medical importance. Book: Biology (Campbell) 11 edition Urry. Cain. Wasserman. Minorsky. Reece
- Describe briefly the perks, disadvantages and use of 16s rRNA genes in taxonomic level of classification of bacteria. Cite the claims to be discussed, only here: https://journals.asm.org/doi/full/10.1128/CMR.17.4.840-862.2004 Create a review format of the task.What are examples of chemical modifications of transcribed RNA(tRNA) ineukaryotes vs. archaea or bacteria?Considering prokaryotes, what is the enzyme that removes the RNA primer and replaces it with newly synthesized DNA?
- Section a) have already answered and the rest of the problems tobe answerd. a) what is the genetic code and explain the properties b) list the difference between eukaryotic and prokaryotic translation initiation c) explain the role E.coli translation elongation factors.With regards to this sequence below please answer this quistions 1) What is the format of the sequence below and why 2) What do you understand by a query sequence 3) What is the sequence size of this sequence 4) What is the ID of the sequence and indicate the taxonomic rank of the ID ATGAAAAAACGAAAAGTGTTAATACCATTAATGGCATTGTCTACGATATTAGTTTCAAGCACAGGTAATT TAGAGGTGATTCAGGCAGAAGTTAAACAGGAGAACCGGTTATTAAATGAATCAGAATCAAGTTCCCAGGG GTTACTAGGATACTATTTTAGTGATTTGAATTTTCAAGCACCCATGGTGGTTACCTCTTCTACTACAGGG GATTTATCTATTCCTAGTTCTGATAGAAAATATTCCATCGGAAAACCAATATTTTCAATCTGCTATTTGG TCAGGATTTATCAAAGTTAAGAAGAGTGATGAATATACATTTGCTACTTCCGCTGATAATCATGTAACAA TGTGGGTAGATGACCAACAAGTGATTAATAAAGCTTCTAATTCTAACAAAATCAGATTAGAAAAAGGA AGATTATATCAAATAAAAATTCAATATCAACGAGAAAATCCTACTGAAAAAGGATTGGATTTCAAGTTGT ACTGGACCGATTCTCAAAATAAAAAAGAAGTGATTTCTAGTGATAACTTACAATTGCCAGAATTAAAACA AAAATCTTCGAACTCAAGAAAAAAGCGAAGTACAAGTGTGGACCTACGGTTCCAGACCGTGACAATGAT GGAATCCCTGATTCATTAGAGGTAGAAGGATATACGGTTGATGTCAAAAATAAAAGAACTTTTCTTTCAC…What function do the prokaryotic rRNAs provide to the ribosome? Question 38 options: A) catalyze the formation of peptide bonds B) base-pair with the Shine-Dalgarno sequence during initiation C) base-pair with the mRNA codons D) base-pair with the tRNAs E) both A and B are correct