draw the Rhizopus and indicate the hyphae, zygospores, and sporangia. (Rhizopus combination) draw and indicate several hyphae, a septum, and sporangia. (Synchytrium endobioticum) draw the lichen indicating the asci (pink) in the cup of the mycelium (blue) (Lichen ascocarps)

draw the Rhizopus and indicate the hyphae, zygospores, and sporangia. (Rhizopus combination) draw and indicate several hyphae, a septum, and sporangia. (Synchytrium endobioticum) draw the lichen indicating the asci (pink) in the cup of the mycelium (blue) (Lichen ascocarps)

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter29: The Fungi

Section29.3: Fungal Diversity

Problem 6LO

See similar textbooks

Related questions

Q: QUESTION 6 Match the best answer for each statement. Amino acids undergo to form polypeptides. RNA…

A: The organic compounds that contain both amino and carboxylic acid functional groups is known as…

Q: Which of the following is TRUE about gametes? a) undergo meiosis b) formed by mitosis c) always…

A: Please note, the given questions are four different questions and not sub-parts of one question.…

Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…

A: Mutation is the change in DNA sequence or the number of chromosomes in an organism. In some cases…

Q: What neurotransmitter(s) does cannabis affect? What kinds of effects does it have on these…

A: The nervous system's nerve cells, or neurons, communicate with one another chemically via…

Q: How is transport mechanism vital in a cell?

A: The transport mechanism is the transfer of chemicals into or out of a cell across the cell membrane.…

Q: Bacteria can grow under a variety of conditions but also have growth preferences. Bacteria that…

A: The need for oxygen may be used to categorize different types of microorganisms. The way that…

Q: 2. How many hydrogen bonds can pyridoxal phosphate (shown below) donate to the surrounding water?…

A: A crucial coenzyme generated from vitamin B6 called pyridoxal phosphate (PLP) functions as a…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: Answer the following (explain in 1-3 sentences) Description: Embryonic Origin: Function: Location in…

A: Tissue is a group of similar cells that usually have a common embryonic origin and function together…

Q: OXWTMA OU G K Т М А Q GKWTMAQC ++ + - ++ - - - - - + - + - + - - + - + - + + + - + + A cistron is…

A: In a complementation chart a group will contain similar mutations that failed to complement one…

Q: What do the preceding tests tell you about the case?

A: Based on the above inquiries and responses, the accompanying data has been obtained:The blood sample…

Q: 2. One of the key pieces of information that Watson and Crick used in determining the secondary…

A: Deoxyribonucleic acid i.e DNA is the molecule that carries our genetic information to the next…

Q: correctly perform and interpret a proteomic analysis, careful attention of which of the following…

A: To conduct a proteomic analysis effectively and interpret the results accurately, several crucial…

Q: For each of the following, identify what characteristics of a species male and female karyotype…

A: Answers and Explanation : 1. Genic : In this case, the ratio of number of X chromosomes to the…

Q: What is the difference between the term hominid and hominin? Explain your answer.

A: Primates are a large and diverse group of mammals. They are classified into two groups:…

Q: If a recombination frequency cannot be above 50%, what does it mean if two genes are, say, 60 mu…

A: Recombination is a process by which two molecules of DNA exchange pieces of their genetic material…

Q: This pedigree (below) shows inheritance of a genetic disorder in a family. Assume the trait is rare.…

A: Gene is the segment of DNA responsible for heredity. Two or more alternative forms of genes…

Q: Please explain why, thanks in advance. A. green - A_B_ and A_bb, virescent-white - aaB_, yellow -…

A: This is an example of dominant epistasis in which the ratio of the offsprings obtained is 12 :3 :1.…

Q: The matching questions below refer to this figure: (relative change) 3.00- 2.00- 1.00 - low N, heat…

A: Answer :- In the context of the experimental data and figure provided, we are examining the role of…

Q: rown atrophy H&E staining Mark the corresponding elements in the picture: 1 - liver beams 2 -…

A: The liver can be susceptible to various pathological conditions that cause atrophy. One such…

Q: Predictors of Eating Disorders Which of the following is the most important predictor of an eating…

A: Eating disorders are intricate battles within the mind. In these types of disorders, there is…

Q: pea plants yellow seed color, (GG) and round seed shape (WW) seeds are dominant traits, wh green…

A: The allele G (dominant) is responsible for yellow phenotype and the allele g (recessive) is…

Q: TAATTGE IGGAG anog regulatory sequence en this interaction map which DNA sequence would the…

A: Transcription regulation is a mechanism in which gene expression is regulated. For this purpose…

Q: Determine the type of hemolysis displayed on this blood agar plate. Drag the appropriate label to…

A: Red blood cell destruction is referred to as hemolysis. Some microbes are categorized based on their…

Q: TERMS BOX Endothermic Exothermic Catabolic Terms that describe this reaction Spontaneous Terms that…

A: Living organisms show metabolic activities in their cells that are responsible for maintaining the…

Q: Draw a diagram/graph to represent the results of an experiment that would prove that there was…

A: Horizontal gene transfer is a method of gene transfer between two unrelated species. Here a…

Q: Which line represents the activation energy of the non-catalyzed reaction? Free energy L a. b. C. d.…

A: Answer : the graph which represents activation energy of non catalyst is : C) cexplaination : non…

Q: Draw fungal structural (spores) are mostly indicated with PINK stain (except in Image 5).

A: As per our company guidelines we are supposed to answer only first 3 parts. Kindly repost other…

Q: You discover a new bacterium. Its cell envelope shows high concentrations of phosphatidylethanolmine…

A: Bacterias are mainly classified in to two types in microbiology. They are:Gram-positive and…

Q: Select ALL of the conclusions that can be drawn from this graph. A Species 1 Seed size Select all…

A: Competition is the relationship where two species compete with each other to survive better.Here…

Q: Why is it necessary to sterilize the loop between streaks when streaking for single colonies?

A: Streaking is a technique used to isolate a pure strain from a single species of microorganism, often…

Q: el Which of the following is a comma-shaped, Gram-negative bacterium that acts as a predator on…

A: Bacteria are relatively simple, microscopic and prokaryotic organisms which lack nucleus and other…

Q: What skeletal trait of P. cookie is different from modern primates? A. P. cookie has no…

A: P. Cookie is an extinct primates and is similar to lemur.

Q: given a phage lysate with 10^11 pfu/ml and a bacterial culture with 10^8 cfu/ml, how would you…

A: phage lysate= 1011 pfu/mlbacterial culture= 108 cfu/mlMOI = 0.1You must combine the phage lysate as…

Q: What letter in the diagram identifies the sporophyte? Which letter in the diagram indicates the…

A: The diagram illustrates the alternation of generations, a common life cycle observed in many plants…

Q: Bacteria that prefer to grow at room temperature at low pH are: Mesophilic acidophiles…

A: Bacterial growth is influenced by many factors such as temperature, oxygen requirements, pH, source…

Q: Identify the following: Description: Embryonic origin : Function : Location in the body: 1. Simple…

A: In the study of anatomy and biology, various types of epithelial tissues play critical roles in the…

Q: In albinism, the formation of melanin, a dark skin pigment, are blocked so that albinos

A: Albinism is a genetic condition that affects the production of melanin, the pigment responsible for…

Q: The following sequence alignment shows the point mutation that exists in hemoglobin for some cases…

A: In the field of molecular biology and bioinformatics, the comparison plus the analysis of the…

Q: can derive nourishment from eating clothing made of natural fibers such as wool (which is rich in…

A: Clothes moth larvae possess a unique ability to nourish themselves by consuming clothing made of…

Q: What results on a microdilution antimicrobial susceptibility test would indicate an antibiotic would…

A: An antimicrobial susceptibility test is a scientific procedure used to evaluate how effective…

Q: 1. Epithelial tissues are classified according to the shape of the cells and number of the cell…

A: Animal tissue known as epithelial tissue creates glands, lines cavities, as well as covers the…

Q: *The normal color of snapdragons is red. Some pure lines showing variation in flower color hav been…

A: The inheritance of flower colors in snapdragons is a classic genetic study that provides insights…

Q: This graph shows the relationship between the number of individuals in a minnow school and how often…

A: The graph is about the minnow size and attacking predators. The graph shows the relationship between…

Q: an F2 generation. If there are a total of 200 F2 flies, how many of the F2 females are expected to…

A: A character is autosomal linked when the gene is present on autosomes and the character is X linked…

Q: fossil record that creates problems when scientists study primate evolution?

A: The fossil record is not a complete chronicle of every organism that has ever lived. Many animals,…

Q: In the three different energy systems, name the energy compounds, and which systems are stressed…

A: In exercise physiology, there are three primary energy systems that the body utilizes to produce ATP…

Q: A rare recessive trait, when exhibited in men, is transmitted to half of their daughters and none of…

A: Genetic disorders are caused due to variants, or mutations in a single gene. These disorders are…

Q: Deoxyribonucleoside triphosphates are the necessary and fundamental monomers for polymerization of…

A: This question addresses why ribonucleoside triphosphates (rNTPs) are required in addition to…

Q: Part A If E. coli bacteria are placed in an environment that contains both glucose and lactose, the…

A: When glucose concentrations are low, E. coli can use other sugars as fuel. The c AMP-CAP protein…

Concept explainers

Embryology

Question

Draw fungal structural (spores) are mostly indicated with PINK stain (except in Image 2).

draw the Rhizopus and indicate the hyphae, zygospores, and sporangia. (Rhizopus combination)
draw and indicate several hyphae, a septum, and sporangia. (Synchytrium endobioticum)
draw the lichen indicating the asci (pink) in the cup of the mycelium (blue) (Lichen ascocarps)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Fungi

VIEW

Step 2: Rhizopus

VIEW

Step 3: Synchytrium endobioticum

VIEW

Step 4: Lichen

VIEW

Solution

VIEW

Step by step

Solved in 5 steps with 3 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Draw fungal structural (spores) are mostly indicated with PINK stain (except in Image 5). draw a small section of the root and indicate the fungus inside the root cells. (Endotrophic mycorrhiza) draw 2-3 asci and their spores (there are always 8 spores per ascus) (Cup fungus apothecium) draw the basidium and spore at the top (usually 4 per basidium). (Coprinus mushroom sporangia) draw the Rhizopus and indicate the hyphae, zygospores, and sporangia. (Rhizopus combination) draw and indicate several hyphae, a septum, and sporangia. (Synchytrium endobioticum) draw the lichen indicating the asci (pink) in the cup of the mycelium (blue) (Lichen ascocarps)
In Figure 4.10, label ascus, ascospore, paraphyses and hymenium In Figure 4.11, label pileus, gills, and stipe In Figure 4.12, label basidia, and basidiospores In Figure 4.13, identify three different types of litchen and label them.
Mark the structures that are observed and identify in the image of mucor racemosus. Sporangioforo Sporangium Sporangiospores Columnel Rhizoids Stolons Zygospores Zygosporangia Gametangia
Please hand draw a Grantia choanocyte with the following terms labeled: spongocoel Please be sure to label the illustration with the term spongocoel.
Match the fungal phylum with the correct spore structures zygomycota [ Choose ] [Choose] zygospores and conidiophores asci and sporangiophores zygospores and sporangiophores asci and conidiophores basidiospores [Choose ] ascomycota basidiomycota
In one paragraph, describe the general fungal lifecycle, including appropriate terms where relevant. You should include both asexual and sexual reproduction in your description.
Describe the unusual morphology of actinoplanete spores
Figure 24.17 Which of the following statements is true? A basidium is the fruiting body of a mushroom-producing fungus, and it forms four basidiocarps. The result of the plasmogamy step is four basidiospores. Karyogamy results directly in the formation of mycelia. A basidiocarp is the fruiting body of a mushroom-producing fungus.
Draw one typical fungal thallus and label the parts.
Many fungal infections of humans are considered to be opportunistic, meaning that fungi that are normally free-living (usually in soil) can sometimes survive, and even thrive, on or inside the human body. From the fungal “point of view,” what unique challenges would be encountered when trying to survive on human skin? What about inside human lungs?
Label the following as A, B, C, D Foot/ Seta/ Capsule Sporangium/ Spore mother cells
Draw allomyces gametangium and label the gametangium and mycelia