Cyclic nucleotides (e.g., CGMP, CAMP) frequently make use of the same parts of the ribose ring; which parts are those, and suggest why this might be found more often than others Select one: a. 3'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form highly unstable (3, 4 membered) rings b. 4'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form highly unstable (3, 4 membered) rings c. 3'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form more stable (5, 6 membered) rings d. 4'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form more stable (5, 6 membered) rings e. 1'-5' connections (most common), 2'-4' connections (less common); these are utilized because they form highly unstable (3, 4 membered) rings

Cyclic nucleotides (e.g., CGMP, CAMP) frequently make use of the same parts of the ribose ring; which parts are those, and suggest why this might be found more often than others Select one: a. 3'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form highly unstable (3, 4 membered) rings b. 4'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form highly unstable (3, 4 membered) rings c. 3'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form more stable (5, 6 membered) rings d. 4'-5' connections (most common), 2'-3' connections (less common); these are utilized because they form more stable (5, 6 membered) rings e. 1'-5' connections (most common), 2'-4' connections (less common); these are utilized because they form highly unstable (3, 4 membered) rings

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 7QP: List the pyrimidine bases, the purine bases, and the base-pairing rules for DNA.

See similar textbooks

Similar questions

The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine 3'-monophosphate, cytosine 2'-monophosphate O B. Adenosine 2'-monophosphate, adenosine 3'-monophosphate, adenosine 21,5'-bisphosphate OC. Guanosine 2'-monophosphate, guanosine 3'-monophosphate, cytosine 3'-monophosphate O D. Cytidine 3'-monophosphate, guanosine 2'-monophosphate, adenine 2'-monophosphate O E. Adenine 3,5'-bisphosphate, guanine 2,5'-bisphosphate, uridine 2'-monophosphate O F. Uridine 2'-monophosphate, uridine 3'-monophosphate, guanine 3'-monophosphate
(a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21
Draw the strucures of Adenosine Triphosphate (ATP) and Cytidine Triphosphate and Show how they combine to form the polynuleotide (i.e. only the end product). Show at any one of these structures where the glycosidic bond occurs
Many antibiotics alter the rate of reaction for enzymes that produce and then cross-link the strands of this polymer together. The image below shows the structure of one antibiotic called penicillin as compared to the portion of the peptidoglycan that undergoes cross linkage. Condon A HS. CH CH CH N-CH cooo Cand cooo wDAla-D-Ala [S] 2. Using the graph above, which condition do you predict was the penicillin condition? 3. Explain how penicillin effects the enzyme. 4. Why it is important to take the full dosage of antibiotics. Briefly explain 5. Is peptidoglycan still being produced in the portion of the graph marked by the circle in condition B?
The enzyme cytidine deaminase catalyzes the conversion of cytidine to uridine. Cytidine deaminase catalyzes the reaction through an addition of water across the cytidine 3,4-bond, forming a tetrahedral intermediate followed by the elimination of NH3 to form the product uridine. This is like the addition-elimination mechanism that we studied for adenosine deaminase. Cytidine deaminase НО. NH₂ N пOH OH cytosine R + H₂O cytidine The Km value for the substrate cytidine is 2.5 × 10-4 M, and the K; for competitive inhibition by the product uridine is 2.5 × 10-³ M. N R A reduced derivative of the product, 3,4,5,6-tetrahydrouridine was shown to be a fully reversible competitive inhibitor with a Ki of 2.4 x 10-7 M, a value approximately 10,000 times lower than that of the product uridine. NH₂ NH uridine HO. N R R = D-ribose HOH OH uridine 3NH uracil ring numbering H NH H H + NH3 H OH H 3,4,5,6-tetra- hydrouridine a.) Draw a structure of the intermediate that we predict to form during the…
The 2',3'-cyclic phosphodiester that is formed (Figure 26.7) when RNA is cleaved, forms a mixture of nucleotide 2'- and 3'-phosphates when it reacts with water. Propose a mechanism for this reaction.
You are presented with Cytidine 5' triphosphate and Thymidine 5' triphosphate. Draw and upload to Efundi these phosphorylated structures as they would be connected in a polinucleotide in the order CpT / Show the individual phosphorylated structures first then show how they combine to form the polynuleotide. Show at any one of these structures where the glycosidic bond occurs
In pyrimidine nucleosides the anti conformation predominates because of steric interactions with pentose. Do thepurine nucleosides have similar interactions?
In a gel electropherosis, Glutamate and valine created a double bond. How is that possible?
Match the following nucleobases (designated AD) with their names and answer questions about them. NH, NH, C D NH2 Note that some of the items from the answer list should NOT be used. Guanine 1. Aand B - Cytosine 2 Cand D • Adenine 3. Not shuwn v Thymine 4. D v Uracil 5. B a Aand C v Which of tho shown bases are pyrimidines? 7. A and O v Which of the shown bases form canonical A-T Watson-Crick base pair? S. A v Which of the shown bases form canonical G-C Watson.Crick base-pair? 9. Band C 10. C 11. Band D
Assume that the 3 polypeptide strands shown below form a parallel B-sheet. Select amino acids AA1, AA2, and AA3 so that the parallel B-sheet is amphipathic and remains stable. Glu-lle-Asn-AA1-Cys-Val Ser-AA2-GIn-Leu-Lys-Phe Lys-Met-Cys-Leu-AA3-Val O AA1 = Pro, AA2 = Leu, AA3 = lle O AA1 = Val, AA2 = Leu, AA3 = Asn O AA1 = Ala, AA2 = Gly, AA3 = Leu AA1 = Phe, AA2 = Arg, AA3 = Ala O O
You are presented with Cytidine 5’ triphosphate and Thymidine 5’ triphosphate. Draw these phosphorylated structures as they would be connected in a polinucleotide in the order CpT / Show the individual phosphorylated structures first then show how they combine to form the polynuleotide. Show at any one of these structures where the glycosidic bond occurs. What would the steps of drawing this be?