Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strand

Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left into two single strands and the replisome is moving from the right to the left of the segment. ___________ should be the template for the lagging strand synthesis. neither of the two strands the bottom strand both top and bottom strands the top strand

Name: Consider the following segment of DNA, which is part of a linear chrom
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Consider the following segment of DNA, which is part of a linear chromosome:LEFT 5’.…TGACTGACAGTC….3’3’.…ACTGACTGTCAG….5’ RIGHT During DNA replication, this double-strand molecule is separated from the right to the left

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Similar questions

The region of DNA, shown below, is being copied. Diagram what happens when the second GT repeat (newly synthesizing strand) slips out (loops out). Diagram what occurs in this and the next round of DNA replication. Describe the change in the DNA sequence that occurs due to this replication slippage. 5’TGCCAGTGTGT3’ACGGTCACACACACATGGAG5’
.5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 6. Which among the two strands will have a continuous replication? 7. Which is the lagging strand? 8. Along which strand will Okazaki fragments appear?
Show the replication strands in each of these bubbles (note they have different DNA orientations). Label each end of each DNA strand and include arrows to show which direction it is extending. Show the Okazaki fragments in the correct places. 3' 5'
Indicate the proteins involved in the following steps of DNA replication in E. coli a. ___________ initiator of replication by binding to the origin of replication of the prokaryote ___________ a dimer that unzips the DNA helix ___________ an enzyme responsible for relieving positive supercoils ahead of replication fork ___________ maintains DNA in single-stranded state ___________ primary replicating enzyme ___________ synthesizes RNA primers The resulting gap by removal of RNA primer is filled in by ___________. h. the resulting nick is sealed by _____________.
(Select one answer from each dropdown menu:) DNA replication uses as templates to make an Choose one: GAUDIe copy of a DNA molecule. complementa DNA replication is known exact molecule has 1 original stChoose one: 1 new strand of DNA. This ensures the conservation of genetic information. because each new DNA (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that are genetically Choose one: This process is used to make Choose one: Match the following Mitosis stages to what happens Prophase Metaphase Anaphase Telophase a. sister chromatids pull apart to opposite ends of cell b. chromosomes line up at the equator of the cell c. Nuclear envelope reforms and chromosome loosen d. nuclear envelope disappears, chromosoměs a. condense During what phase does the cytoplasm divide? (Select one answer from dropdown menu:) Choose one: (Select one answer from each dropdown menu and fill in the blank:) In meiosis, the goal is to get cells that are genetically Choose…
Answer the following questions with regards to DNA replication:1. In what direction does DNA polymerase read the parent strand?2. Describe why Okazaki fragments are formed (1-2 sentences)3. In no more than one sentence describe the function of the following enzymes as it pertains to DNA replication in E. coli : DNA polymerase III, primase and ligase
Below is a diagram of DNA replication as currently believed to occur in E. coli. Arrows start from numbers and end at specific points. Answer the questions relating to the locations specified by the numbers (1) Which end (5' or 3') of the molecule is here? (2) Which enzyme is probably functioning here to deal with supercoils in the DNA? (3) Which enzyme is probably functioning here to unwind the DNA?
Briefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear membrane surrounding the DNA (as in eukaryotes). List and explain three reasons why DNA replication is very accurate.
Match the following descriptions with the enzymes involved in DNA replication. Adds an RNA primer to begin elongation Removes the RNA primer from the beginning of the newly constructed strands Splices lagging strand segments Cleaves the rung of the DNA double helix ladder Description: Answer Answer Answer Answer Enzyme: Helicase DNA Polymerase Primase DNA Ligase
Below is a diagram of DNA replication as currently believed to occur in E. coli. From specific points, arrows are provided that lead to numbers. Answer the questions below relating to the locations specified by the numbers. (02) What end (5’ or 3’) of the molecule is here? (State which) What enzyme is probably functioning here to deal with supercoils in the DNA? What enzyme is probably functioning here to unwind the DNA? What nucleic acid is probably depicted here? What are these short DNA fragments usually called? What enzyme probably functions here to couple these two newly synthesized fragments of DNA? Is this strand the leading or lagging strand? What end (5’ or 3’) of the molecule is here? (State which)
Below is a DNA parent strand. What would be the daughter strand to this? What step of cell replication would DNA replication occur? 3' ATTGCGCATACGAT 5
Briefly explain why DNA replication is semiconservative and discontinuous. Make sure to name the proteins involved in the synthesis of DNA, synthesis of RNA, the removal of RNA, and the sealing of the nicks.