Complete the sentence using one of the choices: A gene is a region of DNA that contains triplet codes that specify individual amino acids a region of DNA that is required for the production of an RNA molecule a region of DNA that contains the information required by ribosomes for the assembly of a polypeptide a region of DNA required for the synthesis of a single protein
Q: Antonie van Leeuwenhoek was the first person to use a microscope and describe tiny animalcules. What…
A: Introduction : A microorganism is an organism too small to be seen by human naked eyes.…
Q: You make reaction progress curve by plotting absorbance vs time (seconds) and find the equation of…
A: LDH measurements are used in the daignosis abd treatment of luver diseases such as acute viral…
Q: Which of the following pathways would you expect to be inhibited by drugs that prevent import of…
A: Explanation: Since the import of proteins into the nucleus is part of the TGF-Beta signalling…
Q: what processes are most likely occurring during lag phase, growth phase (i.e., nucleation,…
A: Microfilaments are composed mainly of actin protein filaments and are essential to the eukaryotic…
Q: Define cell. Enumerate the different classfication/types of cells and define each. What are the…
A: 1. Define cell.2. Enumerate the different classfication/types of cells and define each.3. What are…
Q: QUESTION 8 Let's assume that, in dragons, red scales (B) are dominant to green scales (b), and long…
A: A dihybrid cross is a cross in which two traits are involved. As per the question, two traits are…
Q: he following are the conditions that determines the direction of ions as it pass through the…
A: An ion is an atom or molecule with a net electrical charge present on it. The charge of an electron…
Q: Van Valen's Red Queen Hypothesis explains why.... Algae and other phytoplankton are not abundant in…
A: Natural selection is a crucial topic in biology because it establishes the foundation of…
Q: .) What can you conclude about the location of the genetic determinants of R and S? b.) What other…
A: Maternal effect genes or maternal genes are genes whose mRNA or proteins gets deposited onto the…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: Every living organisms is made up of cells that is the smallest unit of body. A cell is encircled…
Q: QUESTION 9 What is the genetic phenomenon when a person has a specific genotype but phenotypically…
A: In order to create a phenotypic outcome that cannot be expressed by a sigle gene attributed to the…
Q: What happens to cells that use up their available oxygen? they will no longer be able to…
A: Respiration is a catabolic biochemical process that involves the step wise complete or incomplete…
Q: The following are the conditions that determines the direction of ions as it pass through the…
A:
Q: A. Let us see if you can help Draky, who traveled from home to his work using bicycle, but has been…
A: The Blood group follows a codominant mode of inheritance where both alleles show their effect…
Q: Using the oil immersion lens, you estimate 6 human cheek cells can fit across the diameter of the…
A: A microscope is an instrument used to identify and analyse minute objects . There are 4 different…
Q: Where is the energy stored in a molecule of ATP? In adenine In the bonds between the…
A: ATP is the energy currency in the cell.It is chiefly synthesised in the mitochondrion of the…
Q: 2. How does the size of blastomeres compare in size to the original fertilized egg?
A: Developmental biology seeks to study the process in which how different organisms grow and develop.
Q: Provide examples and describe basic structure/function of plasma membrane components – Phospholipids…
A: Some cells, such as unicellular bacteria and protozoa, are complete creatures; others, such as…
Q: Please answer fast a.) define each of the roles of muscles (agonist, antagonist, synerist) and…
A: We need muscles to perform our daily tasks. When we exercise, our muscles burn available food for…
Q: You’ve been noticing that a local pond has developed a green scum that is getting thicker and…
A: Since it frequently causes the degradation of water quality and the reduction of dissolved oxygen in…
Q: Why is it said that photosynthesis and cellular respiration are reverse chemical processes?
A: Photosynthesis :-it is the process of production of food (oxygen and glucose) in the plants by using…
Q: Morphological traits can be mapped onto a tree to add more information. What would the tree look…
A: Morphogenetic traits and phylogenetic trees : The evolutionary relationships between organisms can…
Q: Describe the relevance of Bioinformatics in supporting the progress of Biotechnology.
A: Bioinformatics: Short for "biological Informatics", Bioinformatics is a new field of biotechnology…
Q: Please answer fast Using the cDNA copies of the transcripts from parasite-cells infected with red…
A: Genes are located in an organism's DNA (deoxyribonucleic acid), and each gene governs a distinct…
Q: Why are basic dyes more effective for staining bacteria than acidic dyes
A: Answer: Dyes are the colouring component which are used for many purposes like in microbiology for…
Q: Parathyroid hormone and calcitonin are hormones that work antagonistically. Two other hormones that…
A: Introduction : Chemicals called hormones serve as the body's primary messengers. The endocrine…
Q: to identify the cell organelles labeled in these actual TEMs of human cells; list them on the lines…
A: Cells are building blocks of human body. It consists of nucleus,nucleolus,vacuoles etc. Cells…
Q: 0. What is the probability of a couple to have two boys and one girl. with the eldest being a boy? O…
A: Each cell contains 23 chromosomes in humans. Out of these 23 pairs of chromosomes, there are 22…
Q: The action potential generated in the squid giant axon requires voltage-gated potassium channels.…
A: * Voltage gated potassium channels are transmembrane proteins that opens in response to…
Q: Which of the following is correct about a symporter? it is a form of passive transport…
A: Membrane Transport refers to the movement of substances across the plasma membrane.
Q: alapagos nes Between 1973 and 1978, the population of ground finches (a type of small bird) on the…
A: Answer In 1973,1) The maximum length for the beak of birds was…
Q: Developing morbid obesity seems to require that individuals have a biological predisposition to gain…
A: Obesity can be transferred by gene from one generation to another generation. There have such genes…
Q: The body/mass index (BMI) uses ____ to assess weight range. a. Waist circumference b. Height and…
A: Body mass index (BMI) measures body size. It is determined by knowing the weight in kilograms and…
Q: This type of cell transport does not require energy for the molecules to be transported. Passive…
A: Passive Transport Movement of molecules across cell membranes which requires no metabolic energy and…
Q: Why do vancomycin-resistant bacteria have a higher frequency in the population after treatment with…
A: Vancomycin is a drug that is used to treat infections caused by bacteria. It works by killing the…
Q: Select which statements are true 1. if oxygen concentration in the lumen of the colon increases,…
A: The correct option is 2 and 5
Q: Use the image below to answer questions 2-3. As part of his series of experiments, Connell removed…
A: Introduction : A genus of barnacles in the family Balanidae in the subphylum Crustacea is called…
Q: Using a flow diagram, elaborate on how you would generate a recombinant plasmid that can be used for…
A: Introduction A plasmid is a distinct segment of extrachromosomal DNA that is physically distinct…
Q: Which of the following statements is NOT TRUE about membrane transport? to facilitate movement of…
A: The cell Membrane or Plasma membrane is an external cell layer that acts as a selective barrier as…
Q: Prior to computerized tomographic scan (CT scan) of the abdomen, a patient is instructed to drink…
A: Introduction : Specific Gravity gives us idea about the weight and density of the object. It is a…
Q: What would be the result of the following? the centromere is missing from a cell a chromosome…
A: Introduction A chromosome is a lengthy DNA molecule that contains all or a portion of an organism's…
Q: Compare/contrast – passive diffusion vs. passive carrier-mediated transport – passive…
A: Transport The transport of molecules across the cell wall and cell membrane. It takes place by two…
Q: Which pair of amino acids is charged, polar, and has an amino group on its side chain? a)K, R b)N,…
A: Amino acids:- it is usually acts as building block of peptides and proteins. But, a lot of amino…
Q: ANSWER THE QUESTION PROPERLY Question : Assuming you encountered an unknown microorganism, attempt…
A: Identification of any unknown microorganisms requires a pipeline of different molecular and…
Q: genotype cannot be determined QUESTION 2 Suppose that extra fingers and toes are caused by a…
A: Introduction: Any one of two or more genes that may alternately appear at a specific location…
Q: This type of cell transport happens during secretion of hormones, neurotransmitters and digestive…
A: Introduction Cell transports are the movement of a material through the cell membrane. The chemical…
Q: to facilitate movement of ions and molecules across membranes. to move food, water, and wastes…
A: The cellular membrane is partially permeable and controls the movement of substances into and out of…
Q: 3.12. A pharmaceutical manufacturer wants to investigate the bioactivity of a new drug. A completely…
A: A absolutely randomized unmarried aspect test is an test wherein both: One aspect of or extra…
Q: List at least 3 common issues experienced by women in the second trimester of pregnancy.
A: Introduction:- Pregnancy is the time period in which the proper development of fetus takes place…
Q: compare mature erythrocytes to vigorously exercising muscle with reference to meeting their energy…
A: Erythrocytes are also called red blood cells and are specialized cells that are responsible for…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
13
Step by step
Solved in 2 steps
- Consider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidGiven the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'
- Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first provide the mRNA sequence that would result (in the 5' to 3' direction). Then give the protein sequence this mRNA would encode (in the N to C direction using the 3-letter abreviations and a single space in between). 5'-CTGCGC TAGGCGCAGTAGGGCATCCCACGACA-3' 3'-GACGCGATCCGCGTCATCCCG TAGGG TGC TGT-5' Codon Table: บบบ UUC JUA UUG CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val mRNA sequence: UCU UCC UCA UCG protein sequence: CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UAA UAG CAU CAC CAA CAG Tyr Stop GAU GAC His Gin AAU Asn AAC AAAG} LUS Asp GAA GAG} Glu UGU Cys UGC UGA Stop UGG Trp CGU CGC CGA CGG AGU AGC Arg Ser AGG} Arg GGU GGC GGA GGG (DO NOT include the 5' and 3' numbers or the N and C. Write only the nucleotides and the abreviations for the amino acids. Include no spaces in the mRNA and a single space in between the amino acid…Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- G
- 2) Create an MRNA strand based on the given DNA template strand: TACTTCCTATTITCTTGTCA CCGCACT 3) Using the mRNA codon chart, determine the amino acid sequence for the MRNA sequence determined in question 3. 4) Consider the following double-stranded DNA molecule: Complementary Strand: ATGTGTAGTGCGAGTTGA Template Strand: TACACATCACGCTCAACT a) What would be the amino acid sequence coded for by the template strand of the DNA molecule above?1) Complete the following tables by filling in the DNA sequence, MRNA codons, and the amino acids expected in the final protein (using the MRNA codonstable): DNA TAC CGC TCC GCC GTC GAC AAT ACC ACT MRNA Amino Acid DNA TGA C АTG ATC MRNA AUG ACU AGC UGG GGG UAU UAC U00 UAG Amino Met Ser Trp Tyr Phe Acid DNA TAC CAC CGT ATG GCT GGG AAT ATC MRNA Amino AcidAssume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'
- Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…A Section of a GeneAAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: mRNA codons tRNA anticodons amino acids The section of a gene shown above (AAG ATA CAG GCT CGG TAA) is called the Answer (template or non-template) strand. It is also known as the Answer (sense or antisense) strand. The amino acids are determined from the Answer (DNA or mRNA or tRNA) strandAnswer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.