Q: What is the role of mRNA in protein biosynthesis process? Transfers amino acids to ribosome To bring…
A: Cells create proteins through a mechanism known as protein synthesis. Transcription and translation…
Q: Read the Guilty dentist information. Then use your understanding to answer the following questions…
A: In various research studies, people assume or predict to certain cause and effects called variables.…
Q: The physician has ordered acetaminophen every 6 hours for a child weighing 10 lbs. The…
A: Recommended low dosage of acetaminophen= 200mg/kg/24hrs Weight of the child= 10lbs= 4.5kg
Q: Which of the following are reproductive organs? Select all that apply A. Root B. Leaf C. Stem…
A: In plants, which organs are directly responsible for sexual reproduction, or take part in sexual…
Q: In relation to NSAIDs, describe the mechanism of how tissue damage leads to pain and how NSAIDs,…
A: Nonsteroidal anti-inflammatory drugs, or NSAIDs, are a widely used class of medications that are…
Q: Patient is in severe stomach distress and is unable to swallow any meds due to vomiting, precise…
A: There are several routes of administration for drugs, including: Oral: This is the most common…
Q: explain the steps of what might happen inside a healthy mammary gland epithelial cell after it is…
A: UV light, or ultraviolet light, is a type of electromagnetic radiation with a wavelength that is…
Q: The identity of Kim's biological father is unknown, but it is thought to be either Kevin or Thomas.…
A: DNA fingerprinting is a method of identifying an individual based on their unique DNA pattern. It…
Q: A child weighing 28 pounds is to receive acetaminophen for fever and pain. The recommendations for…
A: Given that weight of the child is 28 pounds. Therefore, weight in kg's = 28 × 0.454 = 12.7 (Because…
Q: Explain how the disruptions in the electron transport chain leads to the production of reactive…
A: The electron transport chain is a series of protein complexes and electron carriers that are located…
Q: The Tropical regions are likely to have more biological diversity than the Temperate ones. Give two…
A: Biome is the distinct ecological community of animals and plants that exist together in a particular…
Q: Lipids most abundant form are Triglycerides building blocks are 1 If a triglyceride only contains…
A: Introduction:- Lipids and Proteins are categorised under bio-macromolecules. Proteins are higher…
Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…
A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…
Q: Name a drug for treatment for overactive bladder syndrome which does not target the muscarinic M3…
A: Overactive Bladder Syndrome or OAB is a medical condition in which the ability of the urinary…
Q: What does MRSA stand
A: Bacteria are diverse kinds of unicellular organisms belonging to the domain prokaryote because they…
Q: Dihybrid Crosses - Genotypes NOW YOU KNOW THE RULES - FOR EACH PHENOTYPE SHOWN IN THE PICTURES, WORK…
A: Introduction A gene exists in two alternative forms known as allele. When both the alleles are same,…
Q: 1. Identify and explain the differences in organelles and energy sources between cellular…
A: Answer : photosynthesis and cellular respiration are two different processes photosynthesis occurs…
Q: What happens when large natural and/or man-made deforestation occur? How does the plant control the…
A: The epidermis of plant cells has specialized openings called stomata. They are crucial to the carbon…
Q: Why is there loss of protein synthesis in hypoxic injury to a cell?
A: Protein synthesis is the process by which cells use genetic information to build and assemble…
Q: List 4 factors that increase O2 extraction to the tissues (muscles).
A: Exercise hyperemia is the term used to describe the increase in blood flow to the skeletal muscles…
Q: Considering both habitat conditions and requirements for successful symbiosis, why should you be…
A: The question is asking about the potential similarities in the microbial symbiots found in two very…
Q: typical prokaryotic cell has about 3,000 genes in its DNA, while a human cell has almost 21,000…
A: Similar genes present in two different organisms is suggestive of some common features that occur in…
Q: Describe and drawing the reproductive cycle of the fungus Penicillium notatum
A: Penicillium reproduces both asexually and sexually. The asexual stage however, is dominant and…
Q: 1. Do you think it is important to understand evolution? List three different ways that evolution…
A: The concept of evolution was given by two scientists Darwin and Wallace. It was based on natural…
Q: 19. In the leaves of most plants, where can chloroplasts be found? a. b. C. d. in the upper…
A: A membrane-bound organelle called a plastid, or chloroplast, is a type that primarily facilitates…
Q: How can you distinguish growth from development?
A: Life starts with a single cell and becomes a complex organism during the course of growth and…
Q: How does pollination take place in water hyacinth and water lily
A: Pollination: The process of transfer of the pollen grains from the anther which is the male…
Q: What are the genotype and phenotype ratios of the potential offspring when a man who has type A…
A: There are phenotypically 4 types of blood group- Type A, Type B, Type AB and Type O. Type A can be…
Q: Do athletes want a higher or lower VO2max? Explain
A: Introduction: The maximal rate at which our bodies can consume oxygen during exercise is known as…
Q: Table 2. Week 53 in Mars greenhouse. H Environmental data at 12:00 p.m. Note from Luke: I don't…
A: The above question is referring to environmental data collected in a Mars greenhouse during week 53.…
Q: peptide bond Primary Structure Secondary Structure Tertiary Structure NH3+ Quatern Structur 2. Using…
A: Amino acids sequences linked together by peptide bonds form the primary structure of a protein. Any…
Q: How can you tell if a protein is stably expressed over time by looking at a pulse-chase analysis gel…
A: Pulse-chase analysis is a method used to study protein synthesis and turnover in cells. In this…
Q: The reason LacZ is frequently used as a reporter gene is: a. The lacZ gene product binds to the…
A: LacZ is a gene of lac operon which codes for β-galactosidase. The reporter genes cause a visible…
Q: HO ↑ A CH3 B choline head group H3C. C glycerol backbone CH3 CH3 < CH3 B- CH3- CH3 C-CH₂-CH O O C 0…
A: A= Sterol group B= Choline C = Glycerol D = Acyl chain
Q: Describe the reason that free chlorine-based solutions and technologies are ineffective against…
A: Introduction: The parasite Cryptosporidium parvum is the cause of the severe diarrheal disease…
Q: Explain this statement "In a sense, the life cycle in the organism".
A: Understanding the life cycle of an organism can help us understand its behavior, ecology, and…
Q: Explain the Life cycle of Plasmodium starting from its entry in the body of female Anopheles till…
A: Plasmodium requires two host for completion of its life cycle a primary and secondary host. That is…
Q: What is the arthropod's role in disease transmission such as malaria? Question 7 options: a)…
A: Arthropods, especially ticks and mosquitoes, are responsible for a number of parasitic and viral…
Q: What is a repetitive element in genomics? What are the types of repetitive elements? What is their…
A: The amount of DNA present in a cell of a person is called as genome. DNA is made up of nucleotides…
Q: Explain the importance of differential gene expression. Why don't cells and organisms simply express…
A: Gene expression is the process by which a gene's information is used to create a functional gene…
Q: Which of the following is NOT true of ionic bonds? They are formed because of the mutual attraction…
A: Ionic bond is also known as electrovalent bond. It is the complete transfer of valence electrons…
Q: Which of the following is generally true about eukaryotic gene regulatory regions? a. All regulatory…
A: Genes are the segments of DNA that code for polypeptide chains. The expression of the genes in…
Q: An experiment was conducted looking at the likelihood to get covid when you are not vaccinated,…
A: The independent variable is the variable that is changed or manipulated by the researcher.
Q: Which of the following groupings of the abdominopelvic regions is medial? a. Hypochondriac,…
A: The ability to correctly interpret an X-ray film is crucial for medical professionals in order to…
Q: Give an example of this question and explain this question: add image if needed to better explain…
A: Our body is made up of multiple organs. Different organs together form a system and carry out a…
Q: Unlock Your Answer the following questions. Explain your answer by citing references and evidence.…
A: The chemical process known as photosynthesis is used by plants, algae, and some bacteria to convert…
Q: In your own words , Explain the structure of the nasal cavity, trachea and alveoli. Linking their…
A: Introduction:- The primary function of the respiratory system's major organs are to eliminate carbon…
Q: What is the difference between coagulatiive and liquefactive necrosis? How are they related to…
A: Necrosis is referred to unprogrammed cell death due to a disease or an injury. It can affect many…
Q: Biological Macromolecules, Fill in the blank: Elements Present C,H,O Macromolecule Carbohydrates…
A: Molecules such as carbohydrates, fats, proteins and nucleic acids are all different types of…
Q: explain this image for the ecoli bacteria mutation trpE
A: Introduction The trp operon is a type of operon system found in E. coli bacteria. The trp operon…
1. Compare and contrast diabetes mellitus and diabetes insipidus.
Step by step
Solved in 2 steps
- 3. What additional facts, information, or evidence would be useful about dieting improving a diabetic condition?2. Enlist some of the conditions that can be observed due to hyposecretion of insulin.1. What factors put someone at the greatest risk for type 2 diabetes? What are the common symptoms of type 1 and type 2 diabetes? 2. What tests are commonly used to diagnose diabetes? What are some of the treatments for diabetes? How do people with diabetes monitor their blood glucose levels?