Answered: Climate change, water and politics are…

Climate change, water and politics are 3 of the 10 fundamental environmental issues. Select one: O a. False O b. True Gon

Understanding Health Insurance: A Guide to Billing and Reimbursement

14th Edition

ISBN:9781337679480

Author:GREEN

Publisher:GREEN

Chapter2: Introduction To Health Insurance

Section: Chapter Questions

Problem 4R

See similar textbooks

Related questions

Q: The Bax gene, codes for a cytosolic protein that plays an important role in apoptosis. Growth factor…

A: BAX gene is a pro apoptotic member of the BCL2 gene family. Correct statements are: - BAX gene is a…

Q: What are the principle and basic concepts of DIFFERENTIAL staining?

A: The simple dye is used in the technique of simple staining to highlight only the specific structures…

Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…

A: BLAST stands for Basic Local Alignment Search Tool (BLAST) This is helpful in finding location of…

Q: Lungfishes Amphibians Mammals Amnion Lizards and snakes Crocodiles Ostriches Feathers Hawks and…

A: According to Bartleby guidelines , we are supposed to answer first three subparts in case of…

Q: An unusual correlation exists between the potency of an inhaled anesthetic and its ability to A)…

A: Answer :- Option (C) is correct. - expand and compress.

Q: Where would the repressor be bound in an E. coli cell (nonmutant) that is NOT growing in lactose? O…

A: In E. coli, lactose is the substrate for the enzyme beta-galactosidase and it regulates the…

Q: Explain what happens to urine flow rate, specific gravity and urinary excretion of chloride in each…

A: As it is mentioned in the question the intake is isotonic that means the osmolarity of the intake…

Q: During a crossover event, more nonrecombinant than recombinant gametes will be produced. O True O…

A: Introduction Crossing over refers to the exchange of DNA between paired homologous chromosomes that…

Q: If corn has 10 chromosomes, how many chromosomes will be present after meiosis I. a. 20 b.10 c. 5 d.…

A: ANSWER) (c) 5 In the meiosis 1 the number of chromosomes is reduced by half. So 5 chromosomes will…

Q: Nonrecombinent phenotypes: Female/males with gray body/red eyes; females/males with yellow…

A: GIven: Recombinant genotypes are forme by linked genes and their ocmbinations where these…

Q: Name and describe the main fuctional macromolecule found in red blood cells

A: Blood is made up of liquid and solids. The liquid part, called plasma, is made of water, salts, and…

Q: Briefly explain the following concepts in relation to delivery and assessment strategies, for each…

A: The qualifications and related units of competency that need to be completed customise for each…

Q: Which of the following things is/are true about this organism? O Phylum Chordata O Agnathan Class…

A: Introduction The given image shows a Sea lamprey. The sea lamprey is a parasitic lamprey native to…

Q: Give the number of cleavage of uvarovite, grosullar, and andradite?

A: Garnet is a mineral group made composed of many closely related minerals. Garnet minerals share…

Q: Segmentation 1. 2. 234 3. 4. 1. 2. 3. 4. Metamerism

A: segmentation metamerism 1) it is process in which organism is divided into two or more parts but…

Q: Explain the following in paragraph form consists of at least five sentences for each question.…

A: Hermaphroditism is the process in which both the types of reproductive organs are present in the…

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Cellular respiration, like burning, results in the complete oxidation of glucose into CO2 and water.…

Q: What are the principle and basic concepts of SHAEFFER-FULTON METHOD? (please explain it thoroughly…

A: Answer

Q: why a mutant Ras is an oncogene causing many human cancers

A: Ras proteins are proto-oncogenes that are frequently mutated in human cancers.

Q: Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t…

A: Biodegradable Nanoparticles (BNPs) are basically particles with matter of interest (such as gene…

Q: Create an artwork portraying the prokaryotic cell (one for archaea and one for bacteria). Explain…

A: Both Archaea and Bacteria are unicellular organisms. In this way they are different from eukaryotes,…

Q: What does the color of Leo’s urine tell you about how concentrated or diluted it is? What about his…

A: 1.Before exercise leo is well hydrated because his urine color is pale yellow this is also supported…

Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…

A: ATP is the currency of the cell and it starts with glycolysis. Glycolysis is the breakdown of…

Q: You are studying a cell line that expresses both GPCR-A and GPCR-B, each receptor binds the same…

A: The G-protein couples receptor signalling is mediated by a seven pass transmembrane receptor located…

Q: Argosomes Cytonemes

A: Cell biology is the study of cell structure and function, and it revolves around the concept that…

Q: what is a good descriptive title for an unkown mircobiology report

A: The proper description of an unknown microbiological agent is as follows: - A #### culture media was…

Q: which protein consists mainly of a helixes a. hemoglobin d collagen b cotton e…

A: The structure of proteins is organized at four levels. The primary structure shows the sequence of…

Q: Explain in detail the process of making beer with process flow diagram.

Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…

A: Definition of Synapse: The specialized junction at which a neuron communicates with a target cell…

Q: Briefly explain the generation and conduction of nerve impulse.

A: INTRODUCTION Neurons (also called neurons or nerve cells) are the fundamental gadgets of the brain…

Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT

Q: What cellular event happens in response to the binding of a growth factor to its respective receptor…

A: As per our company guideline we are supposed to answer only first question or first 3 subparts of…

Q: How could immunoglobulin cross-reactivity between foreign antigens and host cell antigens result in…

A: Introduction Immunoglobulins are antibodies produced naturally by the immune system of the body that…

Q: explain in not more than 5 sentences the priciple in the machine, PLATELET AGGREGOMETER.

A: Platelets These are small cell fragments that are involved in the repairing of wound and clotting of…

Q: Purified proteins can have their mW determined by: Ethanol precipitation O SDS-PAGE O going to taco…

A: The application of scientific and technical principles to the processing of the material by…

Q: Explain the signaling steps that take place after the EGF receptor is dimerized, up to the poiunt…

A: As per our company guideline we are supposed to answer only first question or only first 3 subparts…

Q: Choose the best answer. When the environment changes dramatically: All of these answers are true…

A: Species are a group of organisms that can interbreed and give rise to viable and fertile progeny.

Q: 10. In class we discussed 3 types of plant and animal defenses (not mimicry), name one and give an…

A: Introduction Mimicry is a developed connection between an organism and another thing, usually…

Q: Which of the following are post-zygotic reproductive barriers? a. Different mating songs prevent…

A: The reproductive barriers and reproductive isolation helps in speciation that increases the…

Q: The name of the person who has autism, is an expert on the condition and has written about how…

A: Science and technology have advanced to the point that we can now determine the origins, signs, and…

Q: You are working with a yeast that can undergo fermentation or respiration. You take equal aliquots…

A: Introduction - Fermentation in yeasts produces ethanol and carbon dioxide, both of which can be used…

Q: 7. Your tire blew out on the way coming to this exam. What would your hypothesis for the cause of…

A: A hypothesis is built to determine the effect of a change on a particular occurrence. Hence, in this…

Q: Elaborate the pros and cons of using commercial or synthetic plant hormones.

A: Advantage: Synthetic hormone like auxin can do same function as the natural auxine do. In low…

Q: Question 25 Which of the following RNAS is the product of transcription? A MRNA and tRNA only B FRNA…

A: Answer: D) mRNA, tRNA and rRNA. The product of DNA transcription is RNA it can be in the form of…

Q: Direction: Explain the following in paragraph form consists of at least five sentences Stomates…

A: The evaporation of water in the form of water vapour through the stomata is called transpiration.…

Q: The quail somites transplanted in a conventional order were able to develop normally in the chick…

A: Induction is the process by which the presence of one tissue influences the development of others.…

Q: Choose 1 biotechnology product in the field of medicine. Provide a 1-2 minute monologue about this…

A: The relationship between science and health services is that science creates medicine and methods of…

Q: 5

A: Answer cat ovary with labelling

Q: Name five (5) common, popular, familiar Philippine plants that are used as ingredients in cosmetics.…

Q: Which is most important in catalysis of peptidyl transfer? A Massively parallel sequencing data…

A: Peptidyl transferase is used in the process of translation where protein is synthesized. Proteins…

Concept explainers

Air Pollution

The excess accumulation of pollutants or undesirable alterations in the environment and its resources such as air, water, and land can be referred to as pollution. Pollution affects the components of the environment. Pollution is considered a global issue as it is showing harmful effects worldwide. Metropolitan cities are more impacted by pollution than countryside or villages.

Question

Climate change, water and politics are 3 of the 10 fundamental environmental issues.
Select one:
O a False
O b. True
Gon

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

We encounter so many risks in our daily lives ranging from just crossing the street to get to work or school, to our recreational favorites. How can we justify the resources being spent on environmental risks when those risks may be less than that encountered in a day surfing at the shore, skiing, bicycling or just driving to work?
What do you think is the most important environmental health issue for the world, and why? What is a public health intervention that could help address this issue? (Name and explain.) Minneapolis Minnesota Add the sources as well
What do you think is the most important environmental health issue for the world, and why? What is a public health intervention that could help address this issue? (Name and explain.)
oner Alt oX an H2 tre qu de ult ap m © Sally A. Morgan/Ecoscene/CORBIS b 29. According to the Costa Rica Rainforests Outward Bound School, the rain forests of the world are disappearing at a rate of 80 acres per minute, day and night. In December 2000, 53,694,993 acres of rain forest were destroyed. Which of the following facts illustrates the negative effect of their destruction on the environment? p a about rain forests A. The soil of the rain forest is low in nutrients, so farmers cannot reuse the same land every year. B. Ranchers clear and use the land for pastures for their cattle because land is inexpensive. C. Trees from the rain forest are used to supply the growing population with lumber for homes and furniture. D. The release of carbon dioxide into the air during the burning of the rain forests adds to the greenhouse effect. E. Almost half of the tropical rain forest deforestation occurs in South America.
What is a main way that carbon moves from the atmosphere to the biosphere? (level 2) étv MacBook Air 888 DD F4 F5 F7 F8 F9 F10 # $ & 3 4 9. 7 8 E R Y U D F G H. J K C V M nd com * 00
Waste treatment and bioenergy production are two important areas to protect and conserve the environment. Lütfen birini seçin: O a. True O b. False
1. The use of land is determined by physical and human factors. A. True B. False 2. Waste that is not biodegradable and cannot properly be recycled is filling our oceans and landfills, thus killing wildlife animals. A. True B. False
In which of the following, the use of composting manure helps?controlling the soil erosionsoil formationwater conservationcontrolling Green House Gas EmissionsSelect the correct option from the codes given below: [A] Only 1[B] Only 1 & 2[C] Only 1, 2 & 3[D] 1, 2, 3 & 4
1.What laws or regulatory bodies could have an impact on improving the water quality in the watershed? (Clean Water Act, Philippines Commission on Environmental Quality, Philippines Soil and Water Conservation Board, Groundwater Conservation Districts) 2.What advantages and disadvantages would there be for a farmer of “going green”? Directions: Select the best answer for each of the following multiple-choice questions. 1. How do weather conditions affect fishing success? A. Hot weather makes fish seek cooler water. B. Not always in easily predictable ways C. Snow and ice guarantee fishing success. D. Both A and B 2. Fish in flowing water tend to face: A. Upstream B. Downstream C. Perpendicular to the current D. No particular direction 3. The best time to fish is: A. Mid-day B. Morning and evening C. When there is no wind blowing D. From 2 to 4 p.m. 4. Aquatic resource conservation is: A. Best left to professionals B. Limited to certain times of the year C. Unnecessary because…
Which of the following factors is said to contribute to the Dust Bowl of the 1930s? I. Strong winds and lack of moisture that created a large, dark storm II. Agricultural practices that reduced the amount of grassland III. Soaring (higher) farm prices that caused farmers to work longer hours O l only O II only Ol and II O Il and III
Extreme changes in conditions, such as a volcanic eruptions, can challenge the functioning of ecosystems and can even result in a new ecosystem. O True O False
The IPCC is a body within the United Nations that makes recommendations to governments on how they should manage global carbon emissions. OTrue False