Briefly describe the differences in the transcription and translation processes as they occur in prokaryotic cells and eukaryotic cells. Thank you very much for your help.
Q: What makes it possible to correctly start translation from an mRNA having multiple codons for…
A: Methionine is the amino acid which codes for AUG codon usually.Translation is the process in which…
Q: dsRNA ...
A: Q. Double-strand RNA (dsRNA)________ Answer. Recognized by dicer.
Q: - Fraumeni Syndrome (LFS) is a rare hereditary cancer disease due to a mutation in the TP53 gene.…
A: P53 is a transcription factor and is a tumor suppressor protein synthesized by tp53 gene. P53…
Q: Match the following Prompts An AT-rich region found in eukaryotic promoters is called the box. The…
A: Transcription: The process of synthesis of mRNA transcript from double stranded DNA template by the…
Q: which of the following statements is correct? A proteins make MRNA which then makes genes B genes…
A: Protein synthesis is the essential metabolism occurring in all livings; proteins are made from…
Q: II. Discuss the following aspects of transcription: 1. What is meant by monocistronic or…
A: Transcription has three phases: initiation, elongation, and termination. In eukaryotes, RNA…
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: 20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence…
A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…
Q: Define the Post-translational modifications. ?
A: Post-translational modifications also PTMs are changes made to protein after synthesis and are…
Q: Describe the process of transcription, focusing on the role of RNA polymerase, sigma (σ) factors,…
A: Transcription is a process of transcribing the template DNA into complementary mRNA sequence which…
Q: 29) Which one of the following statements about RNA processing is correct? A) Exons are cut out…
A: The term DNA stands for deoxyribonucleic acid. Deoxyribonucleic acid is the most important…
Q: Review after transcription modification. Match the term and its description. Each term can only be…
A: The process of converting a piece of DNA into RNA is known as transcription. Messenger RNA is made…
Q: B-If a cell capable of de novo synthesis of purine-based nucleotides and has excess amounts of AMP…
A: GMP and AMP are synthesized from the precursor IMP. Aspartate reacts with IMP and forms…
Q: -If the first G get deleted what kind of mutation will happen? Show the change in amino acid…
A: Any Change in the genetic material, which is not caused by recombination, that leads to altered…
Q: Q28. Which of the following is a sequence that would be likely to be bound by a transcription…
A: Transcription factor: To initiate transcription, eukaryotic RNA polymerase requires the help of…
Q: How 6mA controls gene expression ?
A: 6mA is N6-Methyladenine that has epigenetic roles in DNA (deoxyribonucleic acid) modification in…
Q: Translate this RNA transcript: 5' - UUUCUUAUGUGUCGCCGUAAUUGAUAUUAC - 3'. O…
A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…
Q: examples of how RNA secondary structure and catalytic RNAs are important in gene expression
A: The secondary structure of RNA consists of a single nucleotide. RNA folds between complimentary…
Q: a. Explain each of the three primary processes involved in mRNA processing in detail.
A: RNA splicing It is a form of RNA processing in which a newly made precursor mRNA is transformed into…
Q: Q12: The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to…
A: transcription is the process by which dna molecules are used as template to form new messenger rna…
Q: How does the sequence of the primary transcript resemble the sequence of the gene encoding it?…
A: The primary mRNA transcript is practical as soon as it's far synthesized. This is visible when…
Q: Explain about Formation of the RNA Polymerase II Transcription Initiation Complex ?
A: The process of transcription (synthesis of RNA from DNA) is initiated when RNA polymerase binds to…
Q: 1. Which of these activities occur in ER? You can select more than one. Transcription Translation…
A: Endoplasmic Reticulum- It is the largest single membrane- bound intracellular compartment or…
Q: Explain how the mRNA vaccine work and relate to protein synthesis (Moderna and Pfizer vaccines are…
A: mRNA (messenger RNA) is a single-stranded molecule found in all of our cells. It transports the…
Q: B. What is different about the way in which these two DNA sequences increase the rate of…
A: The Catabolite activator protein (CAP) in E.coli activates transcription at more than a hundred…
Q: Why aren't ssb proteins necessary in transcription?
A: central dogma of molecular biology suggests the flow of biological information from dna to rna to…
Q: 15. differntial splicing allows a single gene to produce multiple proteins true or flasev
A: Alternative Splicing or Differential Splicing enables the inclusion or exclusion of particular exons…
Q: Differentiate transcription in both prokaryotic and eukaryotic cells. 2.Discuss the encoding of…
A: Prokaryotes have simple cellular organisation with no nucleus and membrane bound organelles where as…
Q: Briefly describe three stages of transcription. How is transcription initiated? How is…
A: Transcription the process in which RNA is formed from the DNA that is present in the nucleus of the…
Q: III. Discuss the following aspects of translation: 1. How does the location and timing of…
A: According to our guideline we can answer maximum 3 subparts of a question. So, you need to upload…
Q: Describe the three phases of transcription. Be specific for full credit.
A: Transcription is completed in to three states... 1. Initiation of RNA chain formation 2. Elongation…
Q: a- What is genome assembly?
A: Sequence assembly is the process of matching & combining segments from a larger DNA sequence in…
Q: Class: Name: RNA Modification Questions Answer the following questions. 1. What is the initial…
A: # According to our guidelines we can answer only first 3 subparts or in case of short type questions…
Q: NCREASED/DECREASED transcription of target genes. Select one: O a. Decreased ; Decreased O b.…
A: GTPase-Activating Proteins or GAPs act by binding to the GTPase. This enhances the hydrolysis of…
Q: 23 Which of the following statements about mutations are true?
A: The mutation is defined as a sudden, inheritable change in a DNA sequence. The process includes the…
Q: D) the transcription rate is very, very low
A:
Q: In a written paragraph, describe the difference between prokaryotic and eukaryotic TRANSCRIPTION. In…
A: The process in which the information is stored in the DNA and transferred to an mRNA by the process…
Q: B. Briefly describe/summarize what happens in Transcription (focus on the enzymes necessary for each…
A: The replication of DNA is semi-conservative and depends on complementary base pairing.…
Q: 5. How the modification and histone interaction with DNA brought to transcriptional silencing. Use…
A: Yeast Saccharomyces cerevisiae (single-celled fungus microorganisms). Since ancient times, the…
Q: Describe missense and nonsense mutations and how they are different from frameshift mutations.
A: Mutations can be defined as changes in the DNA sequence. It can result from errors in replication or…
Q: 5'-AGA-ACT-AAA-CTA-TCG-CTT-CGT--3' mRNA: original protein
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: Explain alternative splicing Please explain in 5 sentences or less, thank you
A: Gene expression can be defined as the process that uses gene information for the synthesis of a…
Q: shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…
A: A gene is a stretch of nucleotides present in the DNA. DNA or deoxyribonucleic acid is a polymer of…
Q: Review after transcription modification. Match the term and its description. Each term can only be…
A: In humans, each cell's nucleus contains 3 109 base pairs of DNA dispersed among 23 pairs of…
Q: Define both transcription and translation. In addition, describe the role(s) of each of the…
A: The two main steps involved in protein synthesis are transcription and translation. These two…
Q: iii) What does the mutation do to the TMEM16F protein? splicing is unaffected, truncated protein…
A: * Canine Scott syndrome is an inherited blood clotting disorder found in dogs. *dogs with this…
Q: Describe Duchenne muscular dystrophy (DMD) including its cause and symptoms. Then, explain why DMD…
A: Muscles are important to provide mechanical strength to the body. The skeletal muscles associated…
Step by step
Solved in 4 steps
- C. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for analysis and writing your answers) PERFORMANCE TASK-SAY IT WITH DNA: PROTEIN SYNTHESIS Directions: 1. Build the correct mRNA molecule by transcribing the template DNA strand. 2. Figure out the TRNA triplets (anti-codons) that would fit the mRNA triplets (letter by letter). 3. Translate the MRNA codons and find the correct amino acid using the Codon Wheel on page 1. 4. Write in the amino acid (abbreviation) then, record the one-letter symbol of the corresponding amino acid. If you do this correctly, the symbols should spell out a meaningful message in English. Note. "Stp" = "space" (no equivalent symbol, leave it blank) MRNA DNA -> TRNA T А U G A -> A -> Here is a partially solved message... Decode the rest of the message. TT CTT DNA message code CTT | GGG ACT TAG AGC ATT CCT GCC CTT CGA TGC MRNA CUU AUC UUU GAA UGA AUC TRNA GAA UAG AAA CUU ACU UAG Amino Acid abbr. (based on MRNA) Leu Ile Phe…A. =. A Styles Sensitivity Font Paragraph Dictate 7. What are three differences between RNA and DNA? 7. Where is DNA found in the cell? Where is RNA found in the cell? 8. Name the three types of RNA. What is the function of each? Do they function in transcription, translation, or both? 10. What are the steps of transcription? 11. What are the steps of translation? 12. If this is the base sequence of DNA, what is the resulting AA sequence for the following mutations, where mutations and insertions are bolded and deletions are indicated with DNA TAC CGC T C C GCC G T C GA C A AT АСС Аст Mutations: DNA TAC CG C TC C GC C GT C GAC ACT AC C A CT DNA TAC CGG T C C GC GT C GAC A aT ACC AC T DNA TAC CG- T C C GC GTC GACAAT ACCAC T DNA TAC CG CA T CC GCC G T C GACA AT AC ACT What are the consequences of each of these mutations for protein structure? Page 2 of 2 458 words Focus 100%Concept Overview: Protein Synthesis Task 2: Review the process of protein synthesis by placing the cards in their appropriate category. Think before you drop - This is an all or nothing type of question. Double check that you are happy with where you placed all of the options before you submit the knowledge check. Transcription Translation No Answers Chosen No Answers Chosen Transcription & Translation Neither No Answers Chosen No Answers Chosen Possible answers DNA is copied into MRNA Involves tRNA | Occurs in the mitochondria Information in MRNA is used to produce a protein Occurs in the nucleus Involves mRNA Utilizes ribosomes Involves DNA polymerase Involves RNA polymerase Occurs in the cytoplasm :::: :::: ::::
- 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.Q. Deletion of a single AT base pair from codon number 4 can cause a frameshift mutation in a protein-coding gene. Which of the following additional mutations will restore the reading frame back to “normal” such that the original stop codon will still function? (Note that the amino acid sequence will not necessarily be restored back to normal). Adding a base pair into each of the next two codons. Adding a GC base pair back in where the AT pair was deleted. Adding one base to the next codon and deleting one base from the one after that. Deleting a base pair from each of the next two codons. A. 1,2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1,2,3 and 4 are correctDescribe the three phases of transcription. Be specific for full credit.
- a. 0.02z3 ML Below are the general steps of protein synthesis. What is the correct sequence of protein synthesis? 1-ribosome bonds amino acids together; 2-MRNA leaves the nucleus; 3- TRNA molecules pick up amino acids; 4-DNA double helix unwinds; 5-TRNA anticodon links with mRNÁ codon; 6-polypeptide chain completed; 7-MRNA binds to ribosome; 8-mRNA transcibed Select one: a. 6-5-7-3-2-1-8-4 b. 4-2-8-3-7-5-1-6 c. 1-8-6-7-5-3-4-2 d. 4-8-2-7-3-5-1-6 e. 1-2-3-4-5-6-7-8 When using the high power objective, you should not adjust the Select one:A.C. 3.4 Q1. Protein synthesis is carried out by the processes of transcription and translation. A short length of DNA is shown: TACTCGTCGACGATGATC First base (a) State how many codons are present. (b) Using the table below, find the sequence of amino acids resulting from the transcription and translation of the length of DNA. Show your working. U U UUU Phenyl- UCU UUC alanine F UCC UCA -Leucine Lucc UUG-Le G CUU CUC CUA CUG A AUA -Leucine L AUU I AUC Isoleucine Methionine start codon AUG MMet GUUT GUC GUA GUG -Valine V CCU CCC CCA CCG ACU ACC ACA ACG C GCUT GCC GCA GCG Second base -Serine S -Proline P -Threonine -Alanine UAUT UAC A UAA UAG CAU CAC CAA CAG A Tyrosine Y Stop codon Stop codon -Histidine H -Glutamine AAA TAAG-Lysine AAC-Asparagine N GAU Aspartic GAC acid D GAG Glutamic G UGU-Cysteine C E UGC UGA UGG AGU AGC KAGG-Arginine CGUT CGC CGA CGG GGUT GGC GGA GGGJ Stop codon A Tryptophan -Arginine R Serine S R Glycine UCAG G SCAG SCAQ SCAG Third baseWhat happens during transcription? Answer using 3-5 complete sentences and at least 5 of the key vocabulary terms. Answers should be entirely in your own words. Key Vocabulary from Unit 4.2 Transcription Translation DNA MRNA TRNA Amino acid Protein Nucleotide Nucleus Submit Ribosome Codon Base pairs Adenine, Thymine, Guanine, Cytosine, Uracil
- AKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.BONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNAchoices: functional, no transcription, nonfunctional