Br Br OCH3 Br Br Br Br da "OH 'Br NBS DMSO, H₂O OH Br "OH Br Br CH3CH₂OH H₂SO4 [1] BH3 Br Br "OH OH Br OCH₂CH₂ Br OCH₂CH [2] H2O2, HO [1] 9-BBN [2] H2O2, HO a OH Br OH "Br

Q: Draw a Haworth project of a common cyclic form of this monosaccharide:

A: The aldohexose (6-Carbon aldose) is an L-Mannose.It was determined as a sugar in L-form since its…

Q: Be sure to answer all parts. Nitrogen dioxide decomposes according to the reaction 2 NO2(g) 2 NO(g)…

A: Step 1: The ICE table for the given reaction can be constructed as 2 NO2 (g)2 NO (g)O2…

Q: Michael: NaOH Η 요요 NaOH O: ά

A: In case of any doubt feel free to ask.

Q: Write the Equilibrium Expression for each of the three reactions below    1) CH4(g) + 2O2(g) →…

A: EXPLAINED ABOVE

Q: Use bond energies to calculate the heat of reaction: :ɑ—C:+ H—H Round your answer to 3 significant…

A: Step 1: We know that, Heat of reaction can be calculated by using formula as ΔH = ∆H (bond broken)…

Q: 1.) Calculate the pH of 1.20 molar solution of NaF. Write the hydrolysis reaction first. 2.) 20.0mL…

A: Approach to solving the question: Hydrolysis reactions always involve water. Since this is acid-base…

Q: When the Cu2+ concentration is 1.11 M, the observed cell potential at 298K for an electrochemical…

A:

Q: Draw the arrow pushing mechanism for the transfer hydrogenation converting dehydrozingerone to…

A:

Q: Please don't provide handwritten solution.

A:

Q: a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA

A: The DNA segment you've provided, "ATGCAATGATATTGAAGCTTA," is composed of nucleotide bases. These…

Q: 17. What is the Aldol addition product formed from reaction of the following compound with itself? О…

A:

Q: Why does product A form faster than product B? (three correct answers) KCI + KOH KOH КСІ + H₂O…

A:

Q: Ethyl bromide is synthesized by reacting ethylene with hydrogen bromide. H H:Br: C=C X H + H-Br: Н…

A: Step 1: In the given question bond energy values are taken as a standard values  Step 2:bond energy…

Q: Please don't provide handwritten solution ....

A: Hydrolysis reaction definitionIn a hydrolysis reaction, the water is used to break down the chemical…

Q: Click in the answer box to activate the palette. 212 Write the balanced nuclear equation for a decay…

A: The steps to write a balanced nuclear equation for the alpha decay of 212Bi. Step 1: Identify the…

Q: Mr. Gill is attempting to grow some new flowers at home. He knows that flowers and plants alike…

A: Approach to solvinquestion: explanation:s:

Q: please answer in text form and in proper format answer with must explanation , calculation for each…

A: EXPLAINED ABOVE IN DETAILED

Q: Which of the following could trans-1,2-diethoxycyclopentane be directly synthesized from? C O HO HO…

A: Step 1: Information: The given question is based on retro synthetic analysis.In the retro synthetic…

Q: For this question: How SPF blocks UV Rays from the sun please provide a link of a 1 minute video…

A: UV rays, or ultraviolet rays, are a form of electromagnetic radiation emitted by the sun. They have…

Q: 5 5. Solid iron (III) hydroxide, Fe(OH)3 (s), will dissolve in acidic solution. Explain why by…

A: a)The compound, Fe(OH)3 consists of Fe3+(cation)  and OH- (anion) ions. When the compound…

Q: Predict the major products of the following reaction. Be sure to show the stereochemistry of the…

A: Step 1: Step 2:Mechanism Step 3: Step 4:

Q: Water of Hydration Record the mass empty evaporating dish ( or crucible). Record the mass of dish…

A: Step 1:  **Determine the mass of water lost**  * Evaporating dish mass = 29.00 g. * The dish mass…

Q: Rank each set of substituents using the Cahn-Ingold-Prelog sequence rules by numbering the highest…

A: Step 1:

Q: Question 2. A homeowner uses 4.00 x 103 m3 of natural gas in a year to heat ahome. Assume that…

A:

Q: Calculate the pH of a solution that is 0.215M benzoic acid and 0.190M sodium benzoate, a salt whose…

A:

Q: Calculate enthalpy of the reaction below using Hess' Law. 2CO(g) + O2(g) → 2CO2(g) 4H = ? C(s) +…

A: Step 1:

Q: 1016 3. Using Hess' Law, Calculate the standard heat of formation of copper(I) oxide given the…

A: Step 1:Introduction to question :Given ,Reaction 1 :    CuO(s)  → Cu(s) + ½ O2(g)     Δ.Η° = 157.3…

Q: Calculate the pH at the equivalence point in titration 0.100 M solutions of each of the following…

A: Step 1:Step 2:

Q: QUESTION 4 your choice. .ank the following compounds below In terms of acidity and explain CF3CH2OH…

A: Step 1: We know, According to Bronsted-Lowry acid-base theory, an Acid is a H+ donor whereas a Base…

Q: Draw skeletal structure corresponding to each IUPAC name 1,2-dimethylcyclopentene 6-ethyl-2-octyne…

A: Step 1:(A) 1,2-dimethylcyclopentene:There is a cyclic pentene with a double bond as a functional…

Q: Show steps how to get the amount of error (Pduration - Pmarket) for second question in the picture,…

A: Answer to 9b-20:b. -$0.75Here's why:Duration: We don't need the exact duration value for this…

Q: = O Kinetics and Equilibrium 2/5 Bi Calculating an equilibrium constant from a heterogeneous…

A: Given: V=8.3Lmass,gMolarmass,g/mol​2Hg(l)​7.2200.59​+​O2(g)​15.432.00​→​2HgO(s)​11.7216.59​Step 1:…

Q: 1. Why is the soap translucent? 2. What helps the soap retain its water content? 3. Draw a…

A: Figure showing the soap molecules. parts of  gold from japand diamonds.  REFERENCE: 5.2: Soap -…

Q: Problem 68 of 80 Submit Draw the product of the reaction shown below. Ignore inorganic byproducts.…

A:

Q: An arctic weather balloon is filled with 40.3 L of helium gas inside a prep shed. The temperature…

A: Approach to solving the question:Please see attached photos for detailed solutions. Thank you.…

Q: O Kinetics and Equilibrium Calculating an equilibrium constant from a heterogeneous equilibrium...…

A: Step 1:Introduction to question :Given ,Reaction : CaCO3 (s)→CaO(s)+CO2(g)Objective : Calculate the…

Q: ← Problem 23 of 37 Submit Draw the Fischer projection from the Haworth projection shown below. CH2OH…

A: Step 1: Step 2: Step 3: Step 4:

Q: :&;$;$:$$:$$;$;

A: It seems like you're describing a series of reactions involving bromine (Br2) under various…

Q: Ethyl bromide is synthesized by reacting ethylene with hydrogen bromide. H H C=C + H-Br: H H H:Br:…

A: Step 1: GivenH2C=CH2 + HBr → H3C-CH2-BrBondEnergy (kJ/mol)C-H413C=C602H-Br366C-C370C-Br293 Step 2:…

Q: (CH3)3N+ CH₂I acetone

A:

Q: Calculate Grxn at 298 K under the conditions shown below for the following reaction. 5)3 O2(g) → 2…

A:

Q: During an experiment, 0.984 mol of H2 and 0.492 mol of 12 were placed into a 1.38 liter vessel where…

A: To calculate the final (equilibrium) concentrations of H2, I2, and HI, use ICE table to relate…

Q: 4. Assign E or Z configuration to the following compounds. H3C CH2CH3 a) H3CH2C CH2CH2CI H₂C CH₂Br…

A: In case of any doubt feel free to ask.

Q: 5. Assign R,S configuration to the following molecule. HOOC Br H3C a) H H₂N CH3 NC... b) H c) H…

A: Approach to solving the question:R and S nomenclature is used to define the stereochemical…

Q: Predict the product(s) for each reaction below

A: This are the products for the given reaction. Hope this helps, thank you!

Q: An atomic absorption spectroscopy analysis provided the following data for the analysis of Cu in a…

A: Step 1:Absorbance is the dependent variable; it is placed on y-axis.Concentration is independent…

Q: :$;);););):):$;$;

A: Step 1:Since the allylic or benzylic radical intermediates are more stable than non-conjugated C…

Q: Draw the most stable conformation of cis-1-isopropyl-3-methylcyclohexane.

A: **Step 1: Understanding the Structure**Cis-1-isopropyl-3-methylcyclohexane has two substituents:- An…

Q: Please Write SteP by Step Answer Otherwise I give you DISLIKES !

A: Step 1: Step 2: Step 3: Step 4:

Q: please answer in text form and in proper format answer with must explanation , calculation for each…

A: Step 1: Aldol Condensation :Two molecules of an aldehyde or a ketone, containing at least one…