Question: Genetically modified animal that might be approved for human consumption is a super “muscly” pig made by the inactivation of the myostatin gene. During normal development, the myostatin protein prevents the overgrowth of muscles. How would such a pig be achieved using CRISPR? Why would it not considered the GMO?
Q: 18 Students were provided with cubes of slightly alkaline gelatine of different dimensions, containi...
A: From the above data we have to explain a For each block, calculate the ratio of surface area to v...
Q: What's the non trivial problem with Carleton Coon's work in the article of Race is real, But it’s no...
A: Race is a highly flexible way in which societies can lump people and make the groups based on their ...
Q: Mating took place between males and females of a fruit fly, and individuals appeared With the follow...
A: Introduction: In Drosophila, sex determination is determined by a balance of female determinants on ...
Q: are hemocites also carry oxygen | circulate whole body including wing veins circulate only dorsal ve...
A: Blood is a fluid connective tissue. It forms an important part of the circulatory system and circula...
Q: Aside from H&E, what other staining methods are applicable in Golgi apparatus, mitochondria, and nuc...
A: Answer :- Subsequent to trying different things with presenting cells to gold and mercury, Golgi uti...
Q: Examine and compare the life cycles of: Ăscaris lumbricoides, Trichinella spiralis, and Wuchereria b...
A: As parasites, predators, and decomposers of small organisms, nematodes play critical ecological role...
Q: 'Define each type and give 1-2 vaccine per type A. Live Attenuated Vaccines 'B. Inactivated Vaccine ...
A: Given: Vaccines play an important role in keeping us healthy.They protect us from serious and someti...
Q: 15. If a sample has N = 27 cases, the degrees of freedom used in the formula for estimating the popu...
A: Formula of degree of freedom T ~ t df where df = n – 1. For example, if we have a sample of size n...
Q: Collembolans Question 1 options: are arachnids are members of the Paleoptera are hexapo...
A: Answer :- Collembolans are arachnids. Explanation :- Collembolans are the crude Apterygote (wingl...
Q: Traumatic damage to the spinal cord is common. Based on the information in Figure 2 and Table 2, is ...
A: ANSWER: The central nervous system, which consists of the Brain and Spinal Cord, contains two types ...
Q: From the lungs, explain how oxygenated blood gets to the knee From the Arch of the Aorta, e...
A: Lungs are good sources of oxygen. The exchange of gases takes place in the capillaries.
Q: Please describe how automated systems such as the Bac-T alert and the Vitek are used in the Microbio...
A: A microbe is a type of organism that can cause illness or disease, as well as ferment. It's also gre...
Q: Continuing with the side-blotched lizard study... What would be an appropriate control group to use ...
A: There are few points about side-blotched lizard . It is one of the most abundant lizard in arid we...
Q: Define the term negative feedback loop and positive feedback loop and explain how they differ from e...
A: Hormones are secreted by the endocrine glands. They are carried to their target cells by blood. They...
Q: Short Answer Question: Imagine that you are a clinical microbiologist interested in Lyme Disease. Th...
A: Lyme disease is a vector borne disease caused by the bacterium Borrelia burgdorferi and rarely, Borr...
Q: Which of the following structures is not an example of a connective tissue? A. Blood B. Neuron C. C...
A: Cells of animal body that are similar in origin, structure and function are organised to form struct...
Q: Blood in our body changes color as a function of its oxygenation state. Given the spectral data belo...
A: Answer :- The answers are given in sequence: Normal O, Hb dissociation Curve 1 % Saturation of Hb Og...
Q: How can i handle the side effects of hot flashes, nausea, and vomiting from my medication Tamoxifen
A: Tamoxifen is a hormonal therapy use to treat breast cancer. Tamoxifen is an antagonist of estrogen r...
Q: Are carbs all good or all bad? In what ways are they important and in what ways are they detrimental...
A: Introduction: Carbohydrates are macronutrients and one of the three basic sources of energy for our ...
Q: Hemipterans
A: hemipterans is an order of insects , commonly known as true bugs , comprising 80000 species with in ...
Q: How and why did the average toe pad size change in the anole population? Explain how the process of ...
A: ANSWER: How and why did the average toe pad size change in the anole population? These small lizar...
Q: Difference in the beaks of finches found in Galapagos Island compared to those that are found in mai...
A: Darwin observed the Galapagos finches that had a graded series of beak sizes and shapes and predicte...
Q: Make a short poem about reproductive system
A: ANSWER: A short poem on Reproductive System is narrated below.
Q: What mitochondrial enzyme catalyzes this reaction? "ooC COA "ooC H+ CO2 COA + "0oC NH3 NH3 O Delta-a...
A: Porphobilinogen synthase is an enzyme also known as aminolevulinate dehydratase, which is an essenti...
Q: Provided with the evidences on the picture, choose which of these represents descent with modificati...
A: Natural selection as well as other factors can help these alterations get entrenched in a whole popu...
Q: Which types of light cause damage to genetic material? (SELECT ALL THAT APPLY) ultraviolet visible l...
A: ANSWER;- a) Ultraviolet light causes damage to genetic material. Explain;- DNA can be harmed when it...
Q: If you get infected with the Covid-19 virus, cellular immunity is better designed to fight virally i...
A: * corona virus COVID -19 have single stranded positive RNA enveloped virus. *Coronaviruses shows sev...
Q: |Sample D| (A) after RNase Pedestal Type DA 50 00 Conc 323. ngl A260 (10 mm pa) A80 (10 mm pah) 6476...
A: Rna is a nucleic acid which is transcribed from DNA. These rna molecules form secondary structures v...
Q: 3) In 1998 in a forest there are 300 bald eagles, 200 have dark brown head feathers, and 100 have li...
A: The frequency of various genotypes (concerning one gene) in a population of an organism can be ascer...
Q: B. Study the pictures below and explain how they affect the chain of infection. 3. 2.
A: Chain of infection It is a chain that shows how diseases spread. It mainly contains three things the...
Q: Describe the theory of ‘fundamental causes of disease.” 2. Apply this theory to 1.) the epidemio...
A: In simple terms, a disease is a malfunction of an organism's structure or function that is not the r...
Q: Abigail Griffith- Ph... KAbigail Griffith - DN... 100% Genetics Glencoe Reading Essentials.pdf ement...
A: Genetics may be a branch of biology that investigates genes, genetic variations, and living beings' ...
Q: brief summary) about: 1- Lactobacillus 2- Herpes virus 3- SARS virus 4- Ebola virus
A: Biological hazards or biohazards is a collective term used for a wide range of living organisms that...
Q: Gene Linkage, Crossing Over, and Mapping Genotype of Diploids Phenotype Crossover Type Frequency 1. ...
A:
Q: Explain how to differentiate a sawfly from something belonging to another order of insects. Could yo...
A: Sawflies are the insects. The suborder of the Symphyta within the order Hymenoptera alongside ants, ...
Q: In tomato the mutant genes o (oblate=flattened fruit), p (peach=hairy fruit) and s (compound inflore...
A: Parents- Parent 1= + + s= 348 (the highest number) Parent 2= o p + =306 (complementary of parent 1) ...
Q: Freshwater fish have to do what in order to maintain homeostasis? Consume large quantities of water ...
A: The area of the Earth is filled with 75% water. Out of this 75% only 1% of the total water is the fr...
Q: Which of the following constitute plagiarism? (Select the one best answer.) Citing your source, but ...
A: There is no specific definition for plagiarism. Using any other person's work without their consent ...
Q: 2. Briefly describe how photons are created in the x-ray tube? 3. What is primary radiation and wher...
A: X ray tube uses energy to produce X rays. X ray tube is used in wide variety of medical instruments ...
Q: The figure below shows a U-shaped tube with the same level of water (green color) at both sides. Wha...
A: Diffusion is the passive process by which movement of solvent or water molecules between two soluti...
Q: In a dramatic debate that helped to define neuroscience during the Victorian era, two researchers he...
A: Neuroscience It is defined s the branch of science that studied the brain and its impact on behavio...
Q: Describe and explain the molecular and cellular mechanism of the pathogen causing Covid19
A: Covid 19 is enveloped positive-sense RNA virus and is characterized by club-like spikes like project...
Q: Histones are proteins that act as scaffolding for DNA. They contain a large amount of lysine and arg...
A: A histone is a protein that gives chromosomes structural support. Very long DNA molecules wrap aroun...
Q: 1 stanza of poem about reproductive system.
A: ovaries, she said, havethe same salt content asthe sea. you havelittle oceans inside of you!
Q: Why doesn't sickle cell anemia "prove" the existence of biological race?
A: *sickle cell Anaemia is a inherited blood disorder *This disease produce abnormal haemoglobin in a...
Q: -4 Evaluate the extent to which e data supports the suggestion that uman birth defects are a functio...
A: Birth defects are certain defects that are present in the the offspring since birth. All these birth...
Q: Aside from H&E, what other staining methods are applicable in Golgi apparatus, mitochondria, and nuc...
A: INTRODUCTION Hematoxylin and eosin (H&E) stains have been used for at least a century and are st...
Q: What are the roles inhibitory substances and pH indicator in the selective and diffential media? Pro...
A: Selective media - it is used for the growth of only selected microorganisms. Such as, microorganism ...
Q: how do scientists support the theory of evolution?
A: Theory of Evolution claims that all organisms on earth are related and have evolved from a common an...
Q: Catabolism of and contribute the most to production of nitrogenous waste. phospholipids; glycolipids...
A: ANSWER;- Catabolism of proteins and nucleic acids contribute the most to the production of nitrogeno...
Question:
Genetically modified animal that might be approved for human consumption is a super “muscly” pig made by the inactivation of the myostatin gene. During normal development, the myostatin protein prevents the overgrowth of muscles.
- How would such a pig be achieved using CRISPR?
- Why would it not considered the GMO?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Transforming an Animal In order to create the transgenic cow, your lab first needs to create a DNA vector containing the insulin gene. This step involves a considerable amount of scientific terminology. Make sure you understand the meaning of key terms. Match the following terms with their correct definitions. | ampicillin resistance gene 5 restriction site 6 Origin of replication 7 Ligase 2 promoter 3 Xhol Ч ехоn is a region of DNA that is not transcribed. is the location in the plasmid that is recognized by the restriction enzyme Xhol. is an enzyme that joins DNA fragments together. is the location on the plasmid where DNA replication begins. is a region of DNA that initiates transcription of a gene. is an restriction enzyme that looks for the sequence TCGA. is a gene that enables you to identify bacterial cells that have taken up the plasmid.a gm animal that may be approved for human consumption by the time this book is published is a super muscly pig made by inactivation of the myostatin gene. During normal development, myostatin protein prevents the overgrowth of muscles. (Given that effective deletions can be made in the genome by using CRISPR/Cas9. It targets deletions of varied length. By this technique, the transcriptional status of the target gene is not affected. The gene deletions produced by CRISPR/Cas9 lead to the production of the correct type of junctions at very high frequencies), how could the super muscly pig have been generated? Answer the questions in the photo as well. ( i included my answer for 22a in the question above, if you believe you have a better answer by all means include that as well)Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid
- The prospect of using gene therapy to alleviate genetic conditions is still a vision of the future. Gene therapy for adenosine deaminase deficiency has proved to be quite promising, but many obstacles remain to be overcome. Currently, the correction of human genetic defects is done using retroviruses as vectors. For this purpose, viral genes are removed from the retroviral genome, creating a vector capable of transferring human structural genes into sites on human chromosomes within target-tissue cells. Do you see any potential problems with inserting pieces of a retroviral genome into humans? If so, are there ways to combat or prevent these problems?TOPIC: PCR and Gene Cloning Basics Question: What are 2 possible roles of CaCl2 in the transformation process?Complete the following problems. Restriction enzymes (REs), which cut D NA at specific sequences, are classic tools in molecular biology. Because of their specificity in cutting DNA, REs can be used to "map" DNA sequences by analyzing the fragments generated upon restriction digest, as in the example shown in Figure 1. Your task is to study the circular plasmid, pMBBS, through restriction digests. You subjected the pMBBS plasmid to complete digestion by different combinations of three REs (EcoRI, BamHI, and Xhol), and analyzed the results on an agarose gel, shown below. Using the data you can glean from this gel, answer the questions that follow. EcoRI BamHI Xhol *The same total amount of DNA was loaded in each lane. 1. What is the total size of the pMBBS plasmid in bp? Answer: bp + DNA size ladder 2. How many cut sites on the PMBBS plasmid does each RE have? EcoRI: BamHI: Xhol: 3000 bp 2500 bp -2000 bp -1500 bp 1200 bp 1000 bp 900 bp 800 bp 700 bp 600 bp 500 bp 400 bp 300 bp 200 bp…
- Genomic DNA from one of the seven neomycin resistant clones, AB1, that produced a PCR product with primers A/B was further examined by PCR alongside genomic DNA from neomycin resistant fibroblasts that did not generate a PCR product with primers A and B and untransformed porcine fibroblast cells. Clearly and neatly diagram an image of the agarose gelPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAACell and Molecular Biology Subject: 1. Explain how the actions of the lac operon are different from the trp operon. 2. Why is it important for a multicellular organism to be able to turn on only some of its genes in any particular tissue or cell type?
- Please answer fast If the plasmid Lac operon has a mutated lacO operator gene that prevents the repressor from binding, which of the following will occur when lactose is absent? No beta-lactamase will be produced. A functional beta-lactamase will be produced. A non-functional beta-lactamase will be produced. Both a functional and a non-functional beta-lactamase will be produced. If the plasmid Lac operon has a mutated promotor that prevents RNA polymerase from binding, which of the following will occur when lactose is present? No beta-lactamase will be produced. A functional beta-lactamase will be produced. A non-functional beta-lactamase will be produced. Both a functional and a non-functional beta-lactamase will be produced.Instructions: After reading the Khan academy article on the Lac operon, suppose that E. coli sustains a mutation in its gene for the lac operon repressor making the repressor unable to bind to the operator. How would this mutation affect the bacterium's ability to catabolize lactose? Would the mutant strain have an advantage over the wild-type strain?Restriction endonucleases (RE) are one of the most used enzymes in biotechnology for recombinant DNA experimentations. These enzymes consist of three major classes; I, II and III. (i) Why is RE Class II commonly utilized in the labs as compared to Class I and III? (ii) Why is RE referred as Restriction Endonuclease and not Restriction Exonuclease? (iii) Some REs are known as isoschizomers. Describe isoschizomers with an example.