Bating na region of noncoding DNA on chromosome 1. Would these differences be considered a mutation? Why or why not? Yes, the difference in nucleotide sequences between the individuals is a mutation because it will affect the phenotype of the two individuals. Yes, any heritable variation in the nucleotide sequence is considered a mutation, even if that variation is in a noncoding region of DNA. Not enough information was provided to determine if this nucleotide difference is a mutation because the effect on phenotype is unknown. No, the change in nucleotide sequence doesn't appear in a coding region of the DNA and so can't be a mutation.

Bating na region of noncoding DNA on chromosome 1. Would these differences be considered a mutation? Why or why not? Yes, the difference in nucleotide sequences between the individuals is a mutation because it will affect the phenotype of the two individuals. Yes, any heritable variation in the nucleotide sequence is considered a mutation, even if that variation is in a noncoding region of DNA. Not enough information was provided to determine if this nucleotide difference is a mutation because the effect on phenotype is unknown. No, the change in nucleotide sequence doesn't appear in a coding region of the DNA and so can't be a mutation.

Name: 2 A scientist investigating the genome of two related individuals obse
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: 2 A scientist investigating the genome of two related individuals observes a difference of a few nucleotides in one individual compared to the other. The nucleotide differences arein a region of noncoding DNA on chromosome 1. Would these differences

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 11QP: When the human genome sequence was finally completed, scientists were surprised to discover that the...

See similar textbooks

Similar questions

Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Do homologous chromosomes have the same exact NUCLEOTIDE sequences? Why do we only need 23 chromosomes for DNA sequencing, when the two homologous pairs do not have the exact same nucleotide sequences? Why don't we use all 46 chromosomes?
The region of the normal hemoglobin gene used for genetic testing for sickle cell anemia contains a restriction site such that homozygous normal individuals show two DNA fragments. If a single nucleotide change in hemoglobin destroys that restriction site, then how many DNA fragments will be visible on a gel from individuals that are homozygous mutant? What about heterozygotes?
The enzymes BamH I and Bal II recognise different sequences but leave the same stickyends: BamH I: ----------G|G A T C C ------ Bal II: ----------A|G A T C T ------(i)Will the two enzymes result in the same number of fragments in a random DNAsequence? Give reasons.(ii)What’s the advantage of having such a pair of REs? Explain with example.
The human genome contains 3 billion nucleotides arranged in a vast array of sequences. What is the minimum length of a DNA sequence that will, in all probability, appear only once in the human genome? You need consider only one strand and may assume that all four nucleotides have the same probability of appearance.
Ethanol (CH3-CH2-OH) is miscible in water because it is able to form hydrogen bonds with itself and other molecules. However, its structure only allows it to form 1-2 hydrogen bonds. This is one reason why even low concentrations of ethanol in solution are lethal for cells. Based on this information, explain why we can use high concentrations of ethanol to precipitate DNA out of solution. Also, describe/predict the effects of increasing concentrations of ethanol in (and around) a cell on macro-molecular interactions (i.e. on weak bonds). Finally, it is possible to select for yeast that are tolerant to increased concentrations of ethanol. Give an example of a physiological change in yeast cells that might make them resistant to ethanol.
People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder?r B-dif w. (41 (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel (H focai
In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.
Using a laser beam, you isolated several R bands from human chromosomes. Answer the following questions What kinds of genes are present in R bands? Which isochors do you expect to be present in the R band? What class of interspersed repeats will be present in R bands? What class of tandem repeats do you expect to find in RG bands? Would you expect to find telomere sequences in some R bands?
What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?
Pedigree Analysis Is a Basic Method in Human Genetic: What does OMIM stand for? What kinds of information are in this database?
A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.