Q: Compare the structures and functions of the receptor molecules for salty and sour taste; the…
A: In our body, taste receptors are that kind of receptors who can senses the taste of food in oir…
Q: In chapter 8 we read that in tumor cells Rb protein is hyperphosphorylated. In response to that,…
A: p53 suppresses the cell proliferation mediated by the Rb-E2F pathway. Phosphorylation of Rb by…
Q: Gene therapy: a) what disease is it used for? b) what genetic defect causes the disease? c) what…
A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…
Q: Discuss the consequences of diabetes - For example cardiac arrest, loss of limp and other health…
A: Diabetes or diabetes mellitus is a condition in which blood glucose levels are abnormally either due…
Q: Agglutination is used only in vivo. to detect bacterial diseases. often as a substitute for…
A: Agglutination refers to the clumping of cells due to result of aggregation between antigen and…
Q: Name the cells which are : (i) double negative T cells (ii) double positive T cells
A: T cells are a part of immune system and develop from stem cells in the bone marrow. They protect the…
Q: In _______________ the selecting agent is the environment, whereas in _______________ the selecting…
A: Introduction Natural selection is the adaptation and modification of populations of living…
Q: State any five objectives of biological classification.
A: Introduction In this question we will discuss about the objectives of biological classification.
Q: Proof-reading during DNA replication refers to: * O removal of thymine dimers by by excision repair…
A: DNA polymerases are the enzymes that build DNA in cells. During DNA replication (copying), most DNA…
Q: Explain comprehensively how the ganglia originated embryologically? How do these affect the role…
A: The "nervous system", also known as the neural system, is a complicated network of neurons that are…
Q: What is the common ground between evolutionary biologists and developmental biologists who have…
A: Evo-Devo is well stated that they are been sued as the abbreviation for evolutionary developmental…
Q: State whether each of the following statements is True Or False. If it is False, explain why. (i)…
A: 1) Nucleated cells tends to be more resistant to compliment mediated lysis than red blood cells?…
Q: - research and explain about the genetic drift -differentiate founder effect from bottleneck…
A: Introduction Evolution:- Evolution is a process of gradual change in the characteristics of a…
Q: Name the three phases of an action potential. Describe for each the underlying molecular basis and…
A: An action potential is defined as the difference in neuron potential that occurs as a result of…
Q: butterfly wing bird wing un What is the function of each of these structures? How are they different…
A: Analogous are comparable attributes shared by two unique creatures as a result of convergent…
Q: Make a simplified schematic representation of the connective tissue cell lineage derived from…
A: The connective tissue cell lineage derived from hematopoietic stem cells and their functions.
Q: 2. Consider the pre-mRNA molecule shown below. Re-order the events listed, in the sequence they…
A: Introduction : Through transcription process RNA synthesized from DNA. After that RNA processing…
Q: e tissue makeup for life on a large planet with strong gravity; a cold, dry climate; and a thin…
A: The cells responds differently to different types of conditions like varying temperatures, humidity…
Q: Explain sexual reproduction in bacteria?
A: Despite the fact that bacteria do not have true sexual reproduction, they exhibit genetic…
Q: Can the frequencies of all genotypes in a population be determined directly with respect to a locus…
A: The dominant allele causes a dominant phenotype in an individual and is composed of one copy of any…
Q: 5' AUGAGGAUGGCCAGUCAAUUUGA 3' 5' AUGGAUGGCCAGUGCAUUUGA 1. Missense 3' 2. Silent 5'…
A: Frameshift deletion occurs when one or more than one nucleotide in a nucleic acid is removed,…
Q: Following the arrival of an action potential in stimulated cells, synaptic vesicles rapidly fuse…
A: Action potential Is an instantaneous, fast, temporary, and spreading change in the resting membrane…
Q: Are there any parts of the human body that get oxygen directly from the air and not from the blood?
A: *oxygen is an important gases for human body each cell in human body requires amount to oxygen for…
Q: Which condition, aerobic or anaerobic, yields more energy (ATP) ?Why do you think this is ?
A: Respiration It is amphibolic and exergonic cellular process. Multistep enzymatic process. Metabolic…
Q: Identify the major mechanical and chemical defenses that protect internal tissues from microbial…
A: Natural barriers comprise the skin, mucous membranes, tears, earwax, mucus, and stomach…
Q: Which of the following enzymes do not require a DNA template for nucleotide synthesis? *
A: DNA template is a DNA strand which is copied in to a complementary strand of DNA. According to the…
Q: Choose one component of the innate immune system and explain how it is beneficial. This can be part…
A: Immunity that is innate or nonspecific is a protective mechanism that an individual is born with. It…
Q: how does planting of native trees support biodiversity and ecological stability?
A: In 1985, the word "biodiversity" was coined. It is essential in both natural and manmade ecosystems.…
Q: Enzymes are catalytic proteins or RNA molecules that accelerate chemical reactions. Substrates are…
A: Enzymes are biocatalysis that helps to increase the rate of chemical reactions by lowering the…
Q: 9. a. What fossil primate possesses traits of both anthropoids and hominoids? b. What are those…
A: Hominid is a sort of primate that has a place with the family Hominidae. In scientific…
Q: At a high pH the overall charge on a diprotic amino acid is more [ Select ] than the overall charge…
A: The amino acid sequence of a protein can reveals information about its three-dimensional…
Q: What would happen to a polarized epithelial cell tissue if we added a calcium chelating agent…
A: Answer : if we assume calcium chelating agent externally to a polarized epithelial cell tissue then…
Q: Why has the American medical profession risen to itspresent heights?
A: Medical profession is field which provides health care services to patient.like pharmacy, hospital,…
Q: What is single molecule sequencing in real time (SMRT) ?
A: DNA sequencing is a technique for determining the order of the four nucleotide bases found in DNA:…
Q: When does DNA replication occu after the cell divides O before protein synthesis O during cell…
A: Cell cycle is the series of cell division that takes place in a cell as it grows and divides. Cell…
Q: Patients with sever ly reduced C3 levels tend to have а. Increased number of severe viral infections…
A: C3 means complement component is a protein present in the immune system. It is important for innate…
Q: all of the following that are true regarding viruses? Oncogenic viruses stimulate uncontrolled host…
A: All that are true regarding viruses - Answer - 1. Oncogenic viruses stimulate uncontrolled host…
Q: Explain about dideoxy chaintermination sequencing ?
A: Dideoxy chain termination method is also called as Sanger sequencing. This method can be designed…
Q: The recognition sequence to which RNA polymerase binds at the initiation of transcription is found…
A: Ans- False The recognition sequence to which RNA polymerase binds at the initiation of transcription…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Compare and contrast electrical and chemical synapses.
A: When two chromosome joins they form synapsis during the cell division process and it is done between…
Q: Meiotic double strand breaks are repaired by SPO11. * True false
A: Meiotic recombination is the process of reciprocal exchange of genetic material (DNA) between the…
Q: A two-month-old baby is found to lack class I MHC molecules. How would this defect impact his…
A: A large locus present on vertebrate DNA known as the Major Histocompatibility Complex (MHC), has a…
Q: Describe the various functions of the thyroid gland. Creat a data table comparing and contrasting…
A: The thyroid gland is a butterfly-shaped gland located immediately above the collarbone in the neck.…
Q: phrases are used.) CODIS The most useful DNA markers for forensics are in the population and do not…
A: The most useful DNA markers for forensics are SSR in the population and do not contribute to…
Q: The megaspore mother cell of an angiosperm has a diploid chromosome number of 2n=32. This megaspore…
A: The embryo sex formation in angiosperm is very interesting and unique feature that follows a…
Q: 9. For stabilization of disturbed brain functions in mental disease nootropic agents are widely used…
A:
Q: what are the advantage and disadvantages of planting native trees in an urban area
A:
Q: What kind of evidence would indicate that the ability to taste PTC is inherited? Why was it…
A: 1. The ability to taste PTC shows a dominant pattern of inheritance. A single copy of a tasting…
Q: Single strand invasion is promoted by Rad51 protein in Eukaryotes for repair of Double Strand…
A: Homologous recombination is the exchange of genetic material between two strands of DNA. It occurs…
answer each part with increase or decrease
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. The diagram shows a structure of a lipid molecule. What is the name of this type of lipid? b. How many ester bonds are present in this molecule? c. After the lipid molecule above is fully hydrolysed, the polyunsaturated fatty acid enters B-oxidation. (i) How many rounds of ß-oxidation will the polyunsaturated fatty acid go through? а. (ii) Using omega system (@) and delta system (A) to name the polyunsaturated fatty acid.1. The three pKa values for the amino acid astrophan are: 1.9, 7.5, and 9.3. Calculate the isoelectric point of this amino acid if protonation of the group with a pKa = 7.5 results in a positively-charged group.2. Classify the following amino acids as nonpolar, polar basic, polar acidic, or polar neutral. (a) (b) (c) (d) H2N-CH-C-O H2N CH-C OH H2N-CH-C-OH H,N--CH-C-OH CH2 CH-OH CH2 CH, C=0 CH3 CH-CH3 OH CH3 229 OH
- 1. Draw the structures of two dipeptides: aspartic acid-glutamine and methionine-isoleucine with NH₂ and COOH at the amine and carboxylic acid ends. Show the abbreviations for both dipeptides using three-letter abbreviations and 1-letter abbreviations for the amino acid residues.1. Isoelectric point of polypeptide: (1) is pH at which the o-carboxyl and o-amino groups are uncharged. (2) is pH at which the net charge on the molecules in solution is 0. (3) is pH at which the charge of the o-carboxyl group is higher than the charge of the o- amino group. А. (1) only В. (2) only С. (3) only D. (1) and (3) E. (2) and(3)Shown below are three amino acids: H,N-CH-C-o ҫн, H,N-CH-C-o CH, H,N-CH-C-o ČH, Tyrosine Tyr Y Phenylalanine Phe F Alanine Ala A 1. Which amino acid is the least hydrophobic? 2. Which amino acid is most hydrophobic? 3. Which amino acid is intermediate? 4. Explain why (2) is more hydrophobic than (3). 5. Explain why (3) is more hydrophobic than (1).
- 1. Draw the structure of an omega-3 fatty acid, docosahexaenoic acid (DHA, 22:6 (4,7, 10, 13, 16, 19)), and write briefly about their importance.1. What is the isoelectric point (pI) of lysine which has pKa values of 2.1 for the α carboxyl group, 9.7 for the α amino group and 10.5 for the side chain amino group? 2. Which of the following is most likely to be found on the exterior of a protein? A) Pro B) Trp C) Ser D) Glu 3. The type of reaction that forms a peptide bond is A) Elimination B) Hydrolysis C) Nucleophilic substitution D) Condensation1. Draw the structure of the following fatty acids: (a) Stearic acid (b) Arachidonic acid
- 1.Ala-Phe-Lys-Val-Val-Glu From the above polypeptide, what amino acid/s go/goes inside the cell after the following treatment: Chemotrypsin, thermolysin, then finally pepsin. What protein is left undigested? Write the primary structure of the undigested protein? 2.K-V-F-W-P-L-A-Y a.Chemotrypsin treatment b.Trypsin treatment c.Pepsin treatment d.Thermolysin treatment 3.Total acid hydrolysis of a pentapeptide complemented by total alkalinehydrolysis yields an equimolar mixture of 5 amino acids listed alphabetically, ala-cys,lys,phe,ser. N-terminal analysis with phenylisothiocyanate (PITC) generate PTH-ser. Trypsin digestion produces a tripeptide where N-terminal residue is cys and a dipeptide with ser as its N- terminal.Chemotrypsin digestion of the above tripeptide yields ala plus another dipeptide. A.What is the amino acid sequence of the tripeptide B.What is the amino acid sequence of the dipeptide derived from trypsin digestion? C.What is the primary structure of the original…29. Amino Acid Chemistry: Using the amino acid chart provided..Ala-Lys-Cys & give the isoelectric point for the tripeptide. Table 23.2 The pK, Values of Amino Acids pk, a-COOH a-NH3* Amino acid side chain Alanine 2.34 9.69 2.17 9.04 12.48 Arginine Asparagine 2.02 8.84 3.86 Aspartic acid Cysteine 2.09 9.82 1.92 10.46 8.35 Glutamic acid 2.19 9.67 4.25 Glutamine 2.17 9.13 Glycine 2.34 9.60 1.82 9.17 6.04 Histidine 2.36 9.68 Isoleucine Leucine 2.36 9.60 2.18 $ 95 10.79 Lysine 2.28 9.21 Methionine 16 9.18 Phenylalanine 1.99 10.60 Proline 2.21 9.15 Serine 2.63 9.10 Threonine 2.38 9.39 Tryptophan Tyrosine 9.11 10.07 2.20 2.32 9.62 Valine O something else! 5.14 O 8.65 something else! 5.81 9.02 9.57Which of the following statements about amino acids is/are incorrect? 1. Standard amino acids are so named because these are the only amino acids there are. 2. Essential amino acids can be synthesized by the organism. 3. All standard amino acids are optically active. 4. Overall, naturally occurring amino acids are equally likely to be found having either an R or S configuration around the alpha carbon. O 1, 3, and 4 O 1, 2, 3, and 4 1 and 2 O 1, 2, and 3