Activity 1.3: Complete the table. Directions: Explain and give application for each process/tools. Process Explanation Application Restriction enzyme Cloning Plasmid
Q: 7. Which type of blood cell is affected in leukemia? How does the number and appearance of this cell...
A: Leukemia is a cancer which involves blood and the bone marrow.
Q: How does ivf work ?
A: IVF is an abbreviation for in vitro fertilization. It is one of the most well-known forms of assiste...
Q: A footwear company wants to test the effectiveness of its new insoles (soft insole and air-fill inso...
A: Various forms of study designs are there that can be used by researchers in order to obtain evidence...
Q: disease caused by a recessive allele. If a woman who was a carrier for hemophilia married a man who ...
A: Question no 1. Answer is.. A 1/4 child means, out of 4, two male & two female, one male is hemop...
Q: In not more than 200 words or 5 sentences, explain why or why not shark finning used in shark fin so...
A: Corals are categorized under the group Radiata of the animal kingdom.
Q: Why study zoology? The future of man can depend on it! لماذا يدرس علم الحيوان؟ مستقبل الإنسان يمكن أ...
A: Introduction :- Zoology is a part of biology that focuses on the anatomy and physiology, embryology,...
Q: PActivity 2 Direction. Match column A to column B. A B 1. Luteinizing normone (LH) 2. Follicle-Stimu...
A: The chemical messengers that are secreted directly into the blood, which carries them to organs and ...
Q: Reports in the media about stem cells usually state that they “turn into any kind of cell in the bod...
A: There are few points to know about stem cells are: We know that stem cells have quality to to devel...
Q: Question 3 Based on the animation. DNA is a right handed double helix. O True O False
A: Deoxyribonucleic acid is a molecule consist of nucleotide in which contain sugar, phosphate group an...
Q: . Circle & Name functional groups H. C-C-N H. CH2 но CH H,C CH3 HICI
A: A functional group is a collection of atoms in a molecule that have chemically different characteris...
Q: Berkely’s experiment with temperature sensitive viral mutant showed that ----. virus could not make...
A: In uninfected cells, high temperatures raised the endosomal pH, which is where viral RNA enters th...
Q: needs (ie feeding, exchange, reproduction). Your task in this assignment is to 1) identify one such...
A:
Q: Peptidoglycan is composed of: Strands of repeating subunits of G and M with a short stem peptide lin...
A: Given: Bacterial cell wall is made up of Peptidoglycan.Bacterial cell wall provides structure and sh...
Q: Describe the characteristics of a heritable molecule. Why is DNA a good heritable molecule?
A: Given: The characteristics of a heritable molecule DNA.The DNA is a molecule that encodes the geneti...
Q: analyze the results of multihybrid crosses to confirm the principle of Independent Assortment
A: Mendel's keen eye for numbers led him to find segregation and independent assortment, as he states i...
Q: a cancer causing virus causes --- in susceptible cultured cells. a. foci b. plaques 2. Lack of ass...
A: 1. foci
Q: Question 9. Which of the following statements about phospholipids is true? A. Each one has two fatty...
A: The term lipid is associated with an organic macromolecule that can be observed in the cell membrane...
Q: help please !!!! thank you in advance
A: Corona virus (SARS COV 2) is a Positive strand, RNA virus that has caused highly deadly changes in t...
Q: e) and explain
A: The association of 5mC with alternative splicing also challenges the general repressive role of 5mC....
Q: Describe a common source and effect of pulmonary embolism
A: A pulmonary embolism is a disorder in which blood clots form in the lungs and spread throughout the ...
Q: How do NK cells accomplish the task of eliminating unwanted cells?
A: The lymphoreticular system, which includes lymphoid and reticuloendothelial components, is in charge...
Q: A. Entamoeba hartmanni B. Entamoeba coli C. Entamoeba polecki D. Entamaeba gingivalis
A: Answer
Q: Why is E. coli O157:H7 an organism of concern in contaminated foods? The strain is represented as O...
A: E.coli is a prokaryotic organism (bacteria) found in intestine of animals including humans, this bac...
Q: . A dextral snail will express nodal in? 4. Snail embryos with a sinistral coiling are? 5. The first...
A: Snails have shelled gastropods and are inhabited diverse environments such as land, seawater, and fr...
Q: Explain the a gain-of-function mutation ?
A: The physical and functional unit is the term that defines the way of heredity is the gene. A gene i...
Q: Examples of open ended questions about Cell structure.
A: An open-ended question is one that cannot be responded with a simple "yes" or "no" or a fixed soluti...
Q: When someone reads a scientific paper to learn about a new drug, that person should NOT: a. Determin...
A: Drug Drug is any material that is use to treat a disease or lower down the effect of a disease or a...
Q: what is urology ? what are the findings about urology ? Explain the branch of medicine and physiolog...
A: The human urinary system is made of organs like kidneys, bladder. ureters, and urethra. The main fu...
Q: Compare and contrast the subunits of prokaryotic and eukaryotic ribosomes. What is the important app...
A: Prokaryotic creatures are bacteria. They're all tiny and single-celled. Bacteria are classed by a va...
Q: If ligase was defective in a cell, which strand of DNA Replication do you think would be most affect...
A: Replication is the process by which each strand of a dsDNA is reproduced into a new strand in the pr...
Q: Generation a) II II b) c)
A: Pedigree is a family chart showing the inheritance of a particular trait through several generations...
Q: In the lifecycle of an angiosperm, male pollen is produced in the ______ and is transferred to the _...
A: Introduction :- Vascular plants are angiosperms. They have stems, roots, and leaves, among other thi...
Q: State the Synthetic Theory of Evolution
A: During Chares Darwin sea voyage around the world, he noticed species share similarity among themself...
Q: Mary has type O blood type . Frank has homozygous type B blood type. Mary had a child with type O bl...
A: Mary genotype is OO while the male has genotype BB so when we cross these we get BO,BO,BO,BO blood g...
Q: What protein does the P53 code for and why is it important?
A: Answer :- The TP53 quality gives guidelines to making a protein called growth protein p53 (or p53). ...
Q: The size of the deleted chromosomal piece a. is correlated with cytoplasmic streaming only O b.deter...
A: Deletion is a genetic aberration in which a part of chromosome or a DNA sequence is removed during ...
Q: 284
A: The Gs alpha subunit (Gαs, Gsα) is a subunit of the heterotrimeric G protein Gs. Gs alpha subunit is...
Q: In the topic about prokaryotic gene expression regulation, we learned about the LacI-, LacIS, and La...
A: The mutation is considered as a way in which there is the occurrence of diversity in genes. The proc...
Q: each term main entry- give main entry (pronunciation) and definition for each term. Also, listen to ...
A: Hyperglycemia or high blood glucose occurs when the body does not produce enough insulin, resulting ...
Q: Define the term neurotransmitters?
A: Biology words are key concepts and phrases used in the study of life and living beings, which is kno...
Q: Sponges A Cnidarians tral nial ist Flatworms Molluscs Annelids Nematodes
A: There are different phyla in animal kingdoms. All animals are included in the Kingdom Animalia. All ...
Q: Volume 02 (mL) Tube 1 Tube 2 Tube 1 Tube 2 Time (min) Green Light Green Control Blue Light Blue Cont...
A: The process through which green plants and other living organisms convert sunlight into chemical ene...
Q: It is a fact that insects are widely distributed in any type of ecosystem. Some are vectors of causa...
A: Unlike the closed circulatory system found in vertebrates, insects have an open system lacking arter...
Q: How significant is cellulose tape perianal swab to the control of pinworm infection in the community...
A: Pinworms are parasitic worms that are also known as threadworms or seatworms. It's a nematode and a ...
Q: Choose an example from these types of complications. Explain the combination that you picked and the...
A: Diabetes insipidus is first type of diabetes. The complications is.. Excess aur chronic dehydratio...
Q: What are the lineages of the tree of life that we divide into prokaryotes vs. eukaryotes
A: Prokaryotes are unicellular organisms that lack membrane-bound structures including nucleus. Prokary...
Q: SpongeBob SquarePants recently met SpongeSusie Roundpants at a dance. SpongeBob is heterozygous for ...
A:
Q: What is the active and passive transport.
A: Ions and molecules are obtained by the cells from their extracellular fluid. The movement of molecul...
Q: What are the outline the major components of the core concept of cell-to-cell chemica communication
A: Introduction:- Chemical communications are constantly sent and received by cells in multicellular or...
Q: Which of the following protists photosynthesize? Group of answer choices Autotrophs Heterotrophs Mi...
A: According to the question, we have to find out which of the following protists can photosynthesize. ...
Activity 1.3: Complete the table.
Directions: Explain and give application for each process/tools.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- BIOTECHNOLGY Date: Name: Instructor: Section/Group:. POST-LAB QUESTIONS 1. In one or two sentences, summarize the technique of gel electrophoresis. 2. How does the process of gel electrophoresis separate DNA fragments? 3. Why is the fact that DNA has a negative charge so important in the gel electrophoresis process? Biotechnology 165Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question What are the drawbacks/disadvantages/unknowns associated with this genetic process?Topic: Recombinant pharmaceuticals (for the production of insulin, human growth hormone or blood clotting factors) Question When or why is this genetic technology/process used? Who benefits from this genetic technology/process - and how?
- TOPIC: E. coli T4 (T4 Bacteriophage) Include a maximum of 3 sentences, a brief description of their growth. What are the structures responsible for growth and reproduction? What are their physical and nutritional (or chemical) requirements?וןווד ← Q Lab Report 6 worksheets 314 F22 .DOCX File Edit View Insert Format Tools Help A 100% ¿ Summary Grades for Arysta Visser: 23 x M Uh-oh! There's a problem w X b The restriction EcoRI cleaves X + Untitled spreadsheet - Goog X https://docs.google.com/document/d/1mKY1HIgMPRh1kRDCmX7msBF2yf07-ogT/edit Outline Headings you add to the document will appear here. Normal text Times ... 12 + B I U 2 18. The restriction EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3', the restriction enzyme HindIII cleaves at the sequence 5'-AAGCTT-3', and the restriction enzyme BamHI cleaves at 5'GGATCC-3. An 805 bp circular plasmid is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows: 1 Restriction Enzyme(s) EcoRI BamHI HindIII EcoRI and BamHI EcoRI and HindIII BamHI and HindIII 3 Practice ====•=•€ EX Fragment lengths (base pairs) 430 bp, 375 bp 470 bp, 335 bp Lab Report 6…Instruction: Perform BLAST to identify the sources of the three (3) DNA sequences. Provide the information being asked. Species A: ATGTTCACCGACCGCTGATTATTCTCTACAAACCATAAAGATATTGGAACACTATATCTA CTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCCCTAAGTCTCCTTATTCGAGCAGAA CTTGGTCAACCAGGCAACCTTCTAGGTAACGATCACATCTATAATGTTATCGTCACAGCC CATGCGTTCGTAATAATTTTCTTCATAGTAATGCCTATCATAATCGGAGGCTTTGGCAACT GGCTAGTACCCTTAATAATTGGTGCCCCCGACATGGCATTCCCCCGCATAAACAACATAA GCTTCTGACTCCTTCCCCCTTCTTTCCTACTTCTGCTCGCATCCGCTATAGTAGAAGCCGG CGCAGGGACTGGTTGGACAGTCTACCCTCCCTTAGCAGGAAATTATTCCCACCCCGGAGC TTCTGTAGACCTAACCATTTTTTCCCTACACCTAGCAGGCATCTCCTCTATTCTAGGGGCC АТСААСТТСАТТАСААСААТСАТСААТАТААAАССССССGCСАТААСССААТАССАААСА ССССТТTТCGTCTGATCCGTOССТААТСАСАGCAGTCTTACTСТТСТАТСТСТСССAGTACT AGCTGCTGGAАТТАССАТАТТАТТААСAGACGTAACСТСААСАССАCСТТTTCGACCC AGCCGGAGGAGGAGATCCTATCCTATACCAACACTTATTCTGATTTTTTGGACACCCCGA AGTTTACATTCТААТССТАССАGСCTTCGGAATAAТСТСССАСАТТGTAACTTATTACTС GGAAAAAAAGAACCATTCGGATATATAGGTATAGTCTGAGCTATAATATCAATTGGTTTC…
- Assignment_12.pdf - Adobe Reader File Edit View Window Help Оpen 1 / 1 99,1% Tools Fill & Sign Comment 3. Recombinant protein is produced by a genetically engineered strain of Escherichia coli during cell growth. The recombinant protein can be considered a product of cell culture even though it is not secreted from the cells; it is synthesized in addition to normal E. coli biomass. Ammonia is used as the nitrogen source for aerobic respiration of glucose. The recombinant protein has an overall formula of CH1.5500.31N..25. The yield of biomass (excluding recombinant protein) from glucose is measured as o.48 g/g; the yield of recombinant protein from glucose is about 20% of that for cells. How much ammonia is required? What is the oxygen demand? If the biomass yield remains at 0.48 g /g, how much different are the ammonia and oxygen requirements for wild-type E. coli that is unable to synthesize recombinant protein? а. b. с. 24°C 08:39 Berawan 27/04/2022Question. Rewrite the following sentences after correction. (Subject: Biotechnology) The variation in the length of tandem repeat of microsatellite DNA has serious translational affects as this is due to its coding region. Correct: If one parent has sickle cell anemia and other has carrier genotype than there is 25 % chance that any offspring is carrier. Correct: Sickled WBC block the flow of blood and Calcium as they stick together and caused by frame shift mutation. Correct: The N1303K mutation in the CFTR gene of CF patients is autosomal dominant disorder due to insertion of asparagine at 1303. Correct: If a person RBCs have B surface antigen and it will clump with antigen B such clumping indicates Blood type B. Correct: Indirect ELISA can detect polygenic gene expression. Correct:Directions: Given the DNA strand below. Decode the hidden message in the proteins that will be produce in protein synthesis of the given DNA strand. Identify the (1) complimentary DNA strand, (2) mRNA, (3) tRNA, (4) amino acid sequence, and (5) protein. Use the 1-letter symbol of the amino acids to produced to decode the message.
- Please help me answer this reviewer. Determine what the statement is describing. Fill in the blanks with the correct/best answer. 1. A fermentation method used by several industries like the pharmaceuticals, food, textile etc., to produce metabolites of microorganisms using solid support in place of the liquid medium. answer: 2: Whole fish whose DNA has been purposefully altered by directly integrating (or deleting) one or several genes to introduce or modify a targeted character. answer: 3. The process of transferring genetic materials into a living cell using glass micropipettes or metal microinjection needles. answer: 4. Preservation of components of biological diversity outside their natural habitats. Thank you very much for your helpActivity 1. Directions: Inside the box are the different applications of recombinant DNA. Classify if it is under Crop Improvement, Medicines and Industrial Applications. Write your answers on the table below. hybridization production of antibiotics vaccine development transgenic animals transgenic plants production of hormones production of commercially important chemicals diagnosis of diseases production of biofuels production of C4 plants Crop Improvement Medicines Industrial Applications. Throughout downstream processing, various analytical methods must be used to evaluate the effectiveness of unit operations. Provide a method or methods (if more than one is required) for each scenario. Quick determination of the concentration of a purified sample of monoclonal antibody. Determine the concentration of monoclonal antibody in clarified extract. Study aggregation of a protein product without disruption of tertiary protein structure. Characterize phenolics (secondary metabolites and impurities produced by green plant tissue) by identifying phenolic species and relative concentrations.