a. What is the Raly gene? What does it encode? How does it relate to the lethality of Ay? b. A heterozygous mouse AAy does not produce enough pigment and it is yellow. Homozygous individuals die during development, but AAy heterozygous do not. Why? You may use any graphic aid to explain this, if necessary. This means that you may use a Punnett square or a forking segregation diagram, or computations with fractions. c. Explain why there is a non-Mendelian 2:1 yellow/agouti phenotypic ratio in this cross.
Q: What is the difference between a maternal-effect gene and a zygotic gene? Of the following genes…
A: Genes are the basic biological unit of heredity. They are a segment of deoxyribonucleic acid (DNA)…
Q: a. What is the probability that their child will not be affected by this trait? b. A geneticist uses…
A: Inheritance is the process of transmitting the traits from parent to offspring. Traits of an…
Q: When the S.cerevisiae genome was sequenced and surveyed for possible genes, only about 40% of those…
A: Loss of function allele can be created by transposon mediated insertional inactivation. The…
Q: An undergraduate researcher in your lab is studying mutations affecting the wings of Drosophila…
A: Alleles of homozygous bent-winged fly which possesses the normal allele of apterous: ap+be, apbe…
Q: Which of the following statements about paramutation is false?a. A paramutagenic allele can alter…
A: Paramutation is a type of mutation that is defined as an interaction between alleles that leads to a…
Q: The wild-type (normal) fruit fly, Drosophila melanogaster, has straight wings and long bristles.…
A: Wild type fruit fly Drosophila melanogaster posses straight wings and a long bristles. The mutant…
Q: were observed and used to make a map of these genes. Calculate the interference.…
A: Answer. The linkage of the genes in a chromosome can be in the form of a genetic map or linkage map.…
Q: EC1. In drosophila the cw (curly wings) gene and eb (ebony body) genes are found on the same…
A: Hi! Thanks for your question. As you have posted multiple questions and have not mentioned which one…
Q: Review the information on Labrador retrievers above. What are the phenotypic ratios of the F1…
A: Epistasis is a genetic disorder in which the effect of genetic variation depends on the presence or…
Q: mice, the A allele causes agouti fur, the AY allele causes yellow fur and is dominant to the A…
A: The gene in question is thought to be important, and the deadly allele can be dominant or recessive.…
Q: expressing dominant mutant trait, caused by the "A*" allele %3D expressing recessive mutant trait,…
A: Dominant traits are expressed in both situations ie in homozygous or heterogegous condition…
Q: A mutation in a coding region of DNA, but that does not change the amino acid, would almost…
A: *! silent mutation is due to a point mutation that gives different codon transcribed as a synonymous…
Q: Fruit flies express both normal wing shape and vestigial wing shape. The pedigree shows the…
A: Introduction :- Vestigial organs are organs that have no obvious function and are thought to be…
Q: 1. A heterozygous mouse AAy does not produce enough pigment and it is yellow. Homozygous individuals…
A: Within organisms, many various forms of mutations occur, and depending on the type of mutation, it…
Q: Dog coat color genetics is actually more complicated that what is described for the Labrador dog…
A: Labrador are of three coat colours, black, brown and yellow. Genetically most dominant colour is…
Q: In Drosophila, a female fly is heterozygous for three mutations, Bar eyes (B), miniature wings (m),…
A: In terms of genetics and genomics, linkage describes how closely genes or other DNA sequences are…
Q: Albright syndrome is caused by a mutation in a gene that is imprinted. A is the wild-type allele and…
A: AbstractThe disease results from somatic mutations of the GNAS gene, specifically mutations in the…
Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point…
A: Cystic fibrosis is a disease of the mucus secretion in which thick viscid mucus is secreted which…
Q: The coloration of calico cats is also the result of the inactivation of one of a female cat's sex…
A: Calico is only possible in females with genotype XBXR and can't be obtained in males. Because, only…
Q: = expressing dominant mutant trait, caused by the "A*" allele expressing recessive mutant trait,…
A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is…
Q: In mice, the A allele causes agouti fur, the AY allele causes yellow fur and is dominant to the A…
A: Introduction Certain genes are absolutely essential for the survival of an organism and the allele…
Q: The role of the TPMT genotype in response to treatment emphasizes the importance of…
A: TPMT gene synthesizes an enzyme known as thiopurine methyltransferase. This gene has majorly five…
Q: The case of golden labs in which a mutation in a gene for the pigment transport protein results in a…
A: It is given that there are two genes. The first gene encodes the normal pigmentation. The second…
Q: The figure below represents a two-generation pedigree representing the inheritance of hereditary…
A: The restriction fragments length polymorphism (RFLP) arises due to mutation that changes the…
Q: man and a woman have a child with cystic fibrosis. Neither parent has cystic fibrosis. How could…
A: Cystic fibrosis is an inherited life-threatening disorder that affects the lungs and digestive…
Q: What gene is in the middle?
A: The genotypes found most frequently are the parental genotypes. Hence parents are: + + cn and b wx +…
Q: The Figueroa family has a genetically inherited trait called ocular albinism—lack of pigment in the…
A: In the pedigree, both Becky is the carrier of the disease gene while ben is normal as in…
Q: 1. Mr and Mrs Burdesha are planning to start a family. However, Mr Burdesha is concerned that, as…
A: Colour blindness is a rare disorder in which individuals are not able to see specific colours with…
Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point…
A: Cystic Fibrosis - An hereditary disease that affects the lungs and digestive system and can be…
Q: Complete the table below to describe the phenotypic consequences for a loss-of-function allele and…
A: During the development of cancer two genes are contributed that are; proto-oncogene and…
Q: AaBbCc x AaBbcc How would you characterize this kind of relationship between the genes: A-B- (gray);…
A: The jeans always to independent assortment at the time of gamete formation. In spite of the…
Q: Suppose that you are studying the role of Protein B, which you believe plays a role in regulating…
A: Apoptosis is a process of programmed cell death that occurs in multicellular organisms. It is a…
Q: A maternal effect gene in Drosophila, called torso, is found as a recessive allele that prevents the…
A: Introduction The relationship between two variants of a gene is referred to as dominant. Each parent…
Q: Four homozygous recessive mutant lines of Drosophilamelanogaster (labeled 1 through 4) showed…
A: Introduction Heterozygous means that you have inherited various versions of a gene from each parent.…
Q: A woman has blood type B. She had children with a man who has blood type AB. Their biological sons…
A: The ABO blood locus is controlled by the multiple alleles. The allele A and B are codominat with…
Q: Cystic fibrosis (CF) is an autosomal recessive disorder. Several different individual point…
A: Answer: #2
Q: ovide the required information. Show the COMPLETE 7-step method of gene-interaction and epistasis…
A: the allele for the characters drooping ears = EE Non-barking=bb erect ears =ee sometimes bark =BB
Q: Albright syndrome is caused by a mutation in a gene that is imprinted. A is the wild-type allele and…
A: Given: A pedigree. Albright syndrome is caused by a mutation in a gene that is imprinted. A - Wild…
Q: A SNP marker is found linked to the cystic fibrosis gene. Cystic fibrosis is an autosomal recessive…
A: Cystic fibrosis follows autosonal recessive inheritance. This means that both the alleles should be…
Q: For gain-of-function disorders, which of the following treatment strategies is the be . A. Gene…
A: Introduction :- Gain-of-function (gof) genetic illnesses are caused by the ectopic or enhanced…
Q: Our understanding of maternal effect genes has been greatly aided by their identification in…
A: A maternal effect is a phenomenon where the nuclear genotype of a mother is expressed in the…
Q: B 19. The image above shows the Hox gene expression boundaries (colored patches) mapped to the…
A: Answer of the question given below...
Q: 6.8 Define a map unit and explain why map units best reflect the real distances between two genes…
A: Genetic map are used to represent the linkage of genes in a chromosome. Genetic maps are mainly used…
Q: n and various true-breeding mutant strains (all at a single locus) for bristle mutations resulted in…
A: Muller's morph classification is used to classify different types of mutation based on the…
Q: The following diagram shows the genetic map of an individual in the region of a gene that has a…
A: There are fifty percent chances of child getting marfan syndrome because marfan syndrome is caused…
Q: a mutant screen in Drosophila, you identified a gene related to memory, as evidenced by the…
A: Recombination is a crucial term in biology. It is necessary for the creation of gene variants. The…
Q: With the aid of annotated diagrams differentiate between incomplete dominance, complete dominance…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: a) what feature of the genome is likely to be located between the two LD blocks that allows…
A: LD blocks are linkage disequilibrium blocks present in a chromosome. It is defined as an event in…
a. What is the Raly gene? What does it encode? How does it relate to the lethality of Ay?
b. A heterozygous mouse AAy does not produce enough pigment and it is yellow. Homozygous individuals die during development, but AAy heterozygous do not. Why? You may use any graphic aid to explain this, if necessary. This means that you may use a Punnett square or a forking segregation diagram, or computations with fractions.
c. Explain why there is a non-Mendelian 2:1 yellow/agouti
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Prediction If your hypothesis is correct, what will be the predicted ratio of phenotypes in your F, generation? (Punnett square may be used to explain) etv O MacBook Pro 三) 14 @ & 1 2 3 4 6 8. 9 Q W E R T Y P A J K く > C V option command command この つ エ のom either a 15-day-old 1-old guinea pig. Data from the Experiment When you have multiple sets of data, it can be useful to plot them on the same graph for comparison. In the graph here, each set of dots (of the same color) forms a scatter plot, in which every data point represents two numerical values, one for each variable. For each data set, a curve that best fits the points has been drawn to make it easier to see the trends. (For additional information about graphs, see the Scientific Skills Review in Appendix F.) INTERPRET THE DATA 1. First make sure you understand the parts of the graph. (a) Which variable is the independent variable-the variable controlled by the researchers? (b) Which variable is the dependent variable-the variable that depended on the treatment and was measured by the researchers? (c) What do the red dots represent? (d) The blue dots? 2. From the data points on the graph, construct a table of the data. Put "Incubation Time (min)" in the left column of the…Information Since dominance and recessiveness have intricate biochemical explanations, the only way of determining dominance is to cross two individuals that are homozygous (pure) for the two different phenotypes. This produces the heterozygous condition. Whichever phenotype is exclusively expressed is said to be the dominant phenotype. 1. A homozygous blue-eyed mouse with short whiskers mates with a homozygous brown-eyed mouse with long whiskers. All of their offspring have brown eyes and short whiskers. Which alleles are dominant? ? QUESTION 2. A homozygous five-clawed cat is crossed with a homozygous six- clawed cat and all of the kittens have six claws. Which allele is dominant? Dominant 3. In humans, the five-fingered condition is recessive to the six-fingered condition. Yet, most people have five fingers. Explain how this can happen. pes not mean frequent.
- Correct answers already provided! Please don't just tell me the answers bc I know them already. Help me with my own question. I get everything else in this problem other than the third option: Introduce the mutant human HD allele as a transgene into the mouse genome with transgene integration anywhere in the mouse genome. Why is the first question (left) okay with introducing mutant human HD allele and the second question (right) is not? I heard that introducing allele without using CRISPR-Cas9 is very rare and difficult. If so, how does it work in the first problem (Hungtinton's chorea)?Could someone please help me with this grade 11 bio dihybrid cross problem on how to solve this question, using a strategy in detail! Assume that curly hair (C) is dominant to straight hair. Albinism (P ) is recessive to normal skin pigmentation. A woman who is heterozygous for curly hair and albinism has a child. The father is homozygous dominant for curly hair and has albinism. (a) Determine the possible phenotypes for their child. (double-crossing, Punnet square) (how to display the traits) (b) Calculate the four different probabilities of a child beingboth a male and of each phenotype. (steps in solving this) (c) What is the probability that the child will expressalbinism and have curly hair like his father? (steps in solving this)Doctor Kryskowski: The autosomal dominant mode of inheritance and symptoms found in the patients from this family indicate that they suffer from Marfan syndrome. It is an inherited disorder caused by mutations in the FBN1 gene. What is the most feasible (easiest, cheapest, most reliable) way to investigate if this is the correct diagnosis?
- Variations in Phenotype Expression A genetic disorder characterized by falling asleep in genetics lectures is known to be 20% penetrant. All 90 students in a genetics class are homozygous for this gene. Theoretically, how many of the 90 students will fall asleep during the next lecture?"How to Solve Genetic Problems" Using Letters for Alleles For convenience, the genes of an allele pair are usually symbolized by a letter from the alphabet. A large letter is used for the dominant trait and a small letter for the recessive trait. When we want to describe the genotype of an organism, we use both letters to represent the alleles inherited from the parents. For example, free earlobes is a dominant allele and attached earlobes is recessive. You would use a capital "F" to indicate the dominant allele and a small “f" to indicate the recessive allele in describing an individual. 1. Write the three genotypes for earlobe attachment as it applies to the following individuals. a. Heterozygous b. Homozygous Dominant c. Homozygous Recessive 2. When it comes to symbolizing incomplete dominance with letters, it is best to use the letter "C" for one allele and "C'" for the other allele. List the three possible genotypes for hair type. a. Curly b. Wavy c. Straight. Why not use a small…uh ec CV + + 10.5 SC 9.1 scute bristles echinus eyes 9.2 ct + crossveinless wings Table 1: phenotype wild-type tapdance feet crossveinless wings tapdance & crossveinless cut wings 15.9 vermilion eyes V + + 66.8 Drosophila X chromosome Use the map provided above for problems 1 & 2. Problem 1: 11.2 10.9 garnet eyes M A new gene is being investigated in fruit flies. The recessive allele of this gene (t) causes the flies' feet to grow tiny tapdance shoes, while the dominant allele (t*) permits wild-type feet to develop. Preliminary studies indicate that this new gene is located on the X-chromosome. You decided to perform a two-point testcross to determine its position relative to the well-established crossveinless wings gene (cv). You cross a female heterozygous for both genes with a testcross male fly and obtain the male offspring results shown in table 1, below. Using this information, answer the following questions: # male offspring 13 405 401 11 forked bristles a) is the original…
- Based on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes Scales Taste Cells Lateral Line 2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes Effect: ___________________ Fish with Heightened Other Senses References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0 Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish Information: Mexican Tetra…he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in chromosome 16. The globin region of the hemoglobin protein itself consists of 2 alpha chains and 2 beta chains. 1 actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 61 gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 121 ggccctggag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 181 cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 241 caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 301 cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 361 gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 421 gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 481 agccgttcct cctgcccgct gggcctccca acgggccctc ctcccctcct tgcaccggcc 541 cttcctggtc…THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67