Q: silence genes
A: Gene silencing is a mechanism that regulates gene expression to define cell fate and also regulates…
Q: Transcribe and Translate the origininal DNA sequence, then in mutated dna sequence identify the Mrna…
A: Since you have asked the multipart question, we will solve the first three questions for you. If you…
Q: This Z diagram of the light dependent reaction shows how an electron moves from the reaction center…
A: The "Zscheme" describes the oxidation/reduction changes that occur during photosynthesis's light…
Q: A metabolic pathway can have unfavorable reactions within the pathway as long as the total sum of…
A: Introduction Metabolic pathway:- A metabolic pathway is a linked series of chemical reactions…
Q: rostaglandin-endoperoxide synthase 2, also known as cyclooxygenase- or COX-2, is an enzyme that in…
A: Prostaglandins directly act upon nerve endings to induce pain. They may also speed up the process of…
Q: this disorder? (Is it autosomal dominant? Autosomal recessive? X-linked dominant? X-linked…
A: Inheritance inheritance is described as a pattern of transfer of genes from the parental generation…
Q: The diagram below shows some of the major organs involved in human digestion.
A: DIGESTION Digestion is important for breaking down food into nutrients, which the body uses for…
Q: Q16. How many differentially expressed genes can you identify using only 1 sample in each group and…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: How Do Species Form in Hawaii’s “Natural Laboratory” of Evolution?
A: Introduction A species is typically defined as a collection of organisms that can reproduce…
Q: To explain: Whether fungal cells more likely to be animal cells that gained the ability to make cell…
A: There are 10 million species on the planet. Each species is distinct and successfully reproduces.…
Q: To describe: The competitive and noncompetitive inhibitors and also describe the way in which they…
A: Inhibitors are molecules that prevent enzymes and substrates from binding together. Inhibitors work…
Q: Noncyclic photophosphorylation involves a constant source of new electrons. b. production of…
A: Photophosphorylation: It is conversion of ADP to ATP using the energy of sunlight by activation of…
Q: In the diagram below, what molecules do A and B represent? 8 WOLONE B A are lipids and B are…
A: Fluid mosaic model of plasma membrane was given by Singer and Nicolsan. This model explains the…
Q: . Differentiation of the Spemann’s primary organizer requires which of the following?* a.…
A: Spemann’s primary organizer are the transplanted tissue of early gastrulas and its dorsal lip used…
Q: 13. Directional selection means that a. The environment controls which organisms will survive. b.…
A: Introduction Selection:- It is the preferential survival and reproduction or preferential…
Q: An action potential is shown below. At 1 what point in the graph are there lots of sodium ion…
A: Action potentials are a temporary shift (from negative to positive) in the neuron’s membrane…
Q: Experiment 1: An RT-PCR was run on human cells growing in tissue culture under standard conditions,…
A: PCR - Polymerase chain reaction (abbreviated PCR) is a laboratory technique for rapidly producing…
Q: a municipal fisheries officer (MFO) you were assigned to investigate a report on the occurrence of…
A: Aquaculture is the controlled cultivation of valuable aquatic animals such as fish, crustaceans,…
Q: S-TAGTAGGOOGCATOTTTTCCCATACAGATGAAGGATAAACTCGTCTXTAT-3 [x]-cleavage site for CFICFII endonuclease…
A: DNA ( Deoxyribonucleic acid ) is two stranded , ladder like helical structure that functions as…
Q: 1.Make a flow diagram to describe each of the prokaryotic DNA repair mechanism 2. Give 2 examples of…
A: DNA repair is a constant process in the cells where the damage is repaired. The cell contains a…
Q: Which of the following statement is most correct about fevers? CH Fevers are never dangerous. Just…
A: Fever is the temporary increase of body temperature of 98.6 degree F. It is the part of body's…
Q: SUBJECT: GENETICS Topic: Probability 1. Consider albinism a trait to occur in a human family. If…
A: Introduction:- Albinism is an autosomal recessive condition, meaning that it affects exclusively…
Q: Which of the following is not a function of the lymph nodes? They supply lymphocytes for the body a.…
A: Introduction A lymph node is a small bean-shaped structure in the immune system of the body. Lymph…
Q: SUBJECT- GENETICS Topic: The blood group in humans Question: Do some computation for the possible…
A: Introduction :- Blood types are determined by the presence or absence of antibodies and hereditary…
Q: What is the name of the "law" described by the formula in (1) (where R is how related two…
A: The reproductive benefit here means that one organism can pass its genes to future generations by…
Q: health consultation. As a public health worker, how will you address the issues on POOR: a. case…
A: • preventing communicable disease through delivery of vaccines, chemoprevention, vector control and…
Q: A patient who suffered a stroke was asked to read a simple phrase and to repeat it back to the…
A: Q. A patient who suffered a stroke was asked to read a simple phrase and to repeat it back to the…
Q: Occasionally, a person is found who has one blue eye and one brown eye or who has a sector of one…
A: Introduction A mutation is a change in an organism's DNA sequence. Mutations can be caused by…
Q: 29. If bacteria remove O₂ from the medium, the litmus is... a. Reduced by donating electrons to the…
A: In order to understand how bacteria can affect the litmus test, it is important to first understand…
Q: The poly A tail of an mRNA molecule was removed by a deadenylase enzyme before it is recognized by…
A: 1) Option D is correct answer for this question because It is this mRNA which decide the sequence of…
Q: Which of the following is false regarding the gills of fish? O They utilize countercurrent exchange…
A: Apparently gills of fish :- utilize countercurrent exchange to maximize the oxygen uptake. have high…
Q: In insects, the foregut, hindgut, and the tracheal system (except tracheoles) are covered by…
A: The cuticle of insects functions both as an exoskeleton and as a barrier between the living tissues…
Q: What is the importance of feedback systems in the control of hormonal output in mammals? Offer two…
A: A feedback mechanism is a loop in which a product feeds back to control its own production.
Q: Question 13 Staphylococcus aureus toxin responsible for symptoms associated with food poisoning is…
A: Staphylococcus aureus is a Gram-positive round-shaped bacterium.
Q: Proteins are the most structurally sophisticated molecules known, consistent with their diverse…
A:
Q: Energy and cellular functions: The evolution of the Prokaryotic cell type into the Eukaryotic cell…
A: Chloroplasts are structure exclusive to the eukaryotic organisms. This was an important development…
Q: Using the molecules glycerol and fatty acids, show with images how they join via a reaction yielding…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: The "heart" of an insect, is located in the [blank] and is known more technically as the [blank]: a)…
A: An insect has mainly three parts; head, thorax, and abdomen. The insects have an open circulatory…
Q: Insulin-like growth factor 2 (IGF2) is located on chromosome 11. My maternal copy of chromosome 11…
A: The IGF2 gene provides instructions for making a protein called insulin-like growth factor 2. It…
Q: Sample A: Sample B: Sample C: Sample D: Sample E: Sample F: 22mm 18mm 35mm 30mm 28mm 28mm 21mm 17mm…
A: Introduction The zone of inhibition is the area around an antibiotic pot where bacteria cannot grow.…
Q: The anterior structure of the Drosophila is promoted by which of the following events?* a. nanos…
A: The Drosophila embryo provides an excellent model for studying gene regulatory networks. In…
Q: In humans the wall of the left ventricle is thicker than that of the right ventricle. This…
A: Cardiovascular system The circulatory system is also referred to as the cardiovascular system. It is…
Q: (c) Use the image below to complete the following: Circle a nucleotide. Label the sugar and…
A: Deoxyribonucleic acid (DNA) is an organic chemical that contains genetic information and…
Q: Ten glyceraldehyde-3-phosphate (G3P) produced by the Calvin cycle is used to produce a. 5 glucose.…
A: Photosynthesis is a metabolic process in which organic material ( glucose ) is synthesized from…
Q: To examine: Whether the statement "Loops of polypeptide that protrude from the surface of a protein…
A: Proteins are essential dietary components. It is made up of a polypeptide chain, which is a chain of…
Q: e. None of these 8. An earthquake hits the bay area, and you and your family have the choice of…
A: Energy efficiency It means doing the same work but using less energy while doing it.
Q: The West Nile virus has what mode of transmission? a) Propagative b) Cyclo-propagative c)…
A: Answer- propagative
Q: Describe the significance of oxygen in the last phase of aerobic respiration using specific examples
A: In This question we have to describe about role of oxygen in aerobic respiration and aerobic…
Q: What role do feedback mechanisms play in the regulation of hormone production in mammals? Give two…
A: Regulation of hormone production The control of the production of hormones is vital for the process…
Q: Which of the following molecular events is NOT involved in Drosophila ventralization? a. Easter…
A: NOTE: since you have posted multiple questions so we will be solving the first three for you. As per…
A specific kind of ascocarp exhibited by the genus Physcia.
Step by step
Solved in 2 steps
- Life cycle development or stages that are unique to the phylum Ctenophorasystemic mycoses important features in tablulated formParasites and common name of the following: Hymenolepis nana- Dipylidium caninum- Fasciolopsis buski - Metagonimus yokogawa- Paragonimus westermanni- Loa loa- Schistosoma haematobium- Taenia saginata- Fasciola hepatica- Opisthorchis felineus- Diphyllobothrium latum- Clonorchis sinensis - Dracunculus medinensis- Taenia solium- Schistosoma japonicum- Hymenolepis diminuta- Heterophyes heterophyes- Echinococcus granulosus-
- Parasites and their infective stage to human of the following: Opisthorchis felineus Paragonimus westermani Taenia saginata Loa loa Diphyllobothrium latum Trichinella spiralis Hymenolepis diminuta…Description (1-2 paragraph) and taxonomic account of: Gemmule Grantia Euplectella EuspongiaRhizopus (bread mold) reproduces both sexually and asexually. Rhizopus' sexual reproductive structure is called? Conidia The zygosporagium The ascus