A non-coding DNA strand has the sequence below: GTACCGATATAATCGGGCTA What is the MRNA sequence that corresponds to the DNA sequence above?
Q: Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence…
A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…
Q: What would be the mRNA strand if the DNA strand reads: TACCGAGTCACG?
A: Transcription and translation are processes that a cell employs to create all of the proteins…
Q: A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this,…
A: The central dogma of molecular biology tells us how protein is made from a DNA sequence. This…
Q: If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA…
A: There are 4 nitrogen bases present in DNA, these are Adenine, Thymine, Cytosine, and Guanine.…
Q: What is the mRNA coded by this template DNA strand? DNA Template Strand: 3' ATGGTACGGTCG 5' O5'…
A: Transcription Through the process of transcription, the sequence of DNA gets transformed into the…
Q: The DNA sequence contains the complete sequence for a small gene. What amino acid sequence does this…
A: DNA sequence of genes code for the sequence of amino acids in proteins. There are two strands in…
Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…
A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…
Q: transcribed RNA
A: Transcription is the process of copying a segment of DNA into RNA. Only one of the two DNA strands…
Q: If the base sequence of template strand reads GCCATTAC, what is the base sequence of the mRNA? O A)…
A:
Q: If the template strand of DNA has the sequence 5'AATGCCTATA3', the MRNA sequence that is transcribed…
A: Transcription is the first of several steps in gene expression in which a particular segment of DNA…
Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…
A: The process of producing protein by association of mRNA and ribosomes is called translation. The…
Q: If the sequence of one chain of a DNA double helix is TAACGTA, the sequence of its partner strand in…
A: Chargaff's rule express that DNA from any species of any life form ought to have a 1:1 protein…
Q: The following DNA strand is the CODING strand. What is the sequence of the RNA which is transcribed…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: How is a protein made in the cell? * O One strand of DNA in the ribosome combines with amino acids.…
A: Translation is the process of formation of a sequence of amino acids using messenger RNA as a…
Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…
A: BASIC INFORMATION TRANSLATION It is the process in which protein is which formed from the…
Q: A gene contains the sequence GGCTAAC. What is the sequence of the MRNA transcribed from this strand…
A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…
Q: If mRNA is UUACGC what is the DNA? Read from right to left. O TGCATT O UGCATU O TTUCGC UCGUTT AATGCG
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA…
A: The replication is the process of new DNA synthesis from the old DNA. The transcription is the…
Q: 5’GCTATAAAGCGTATCGCGTCATA 3
A: Complementary mRNA 5’GCT ATA AAG CGT ATC GCG TCA TA '3 3'CGA UAU UUC GCA UAG CGC AGU AU '5
Q: DNA strand with the sequence 3’ AACGTAACG 5’ is transcribed. What is the sequence of the mRNA
A: Messenger RNA (mRNA) is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: Which sequences are spliced out of the mRNA strand before leaving the nucleus? In other words,…
A: Answer: TRANSCRIPTION : It is the process in central dogma where a DNA strand is transcribed in to…
Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…
A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…
Q: Which is the DNA template given if the MRNA is 3- CGGAUGCCCGUAUAC -5 ? O 3- GCCTACGGGCATATG-5 O 5-…
A: The common rule of Base pairing in DNA is: A pairs with T by a double bond and G pairs with C by a…
Q: What is the base sequence of the mRNA synthesized from the following DNA template strand?…
A: In order for a gene to be converted into a functional protein, two processes must take place namely…
Q: 1. One strand of DNA has the base sequence: CGATTGGCAGTCAT. Determine the sequence of bases in the…
A: The sequence of bases of complementary mRNA from DNA strand can be determined as follows: DNA mRNA…
Q: Transcribe the following DNA strand into a MRNA strand. TAC a AUG ATG TAC DIY
A: Transcription is the process by which DNA code of a gene into mRNA code.
Q: What would be the mRNA strand if the DNA strand reads: T A C C G A G T C A C G?
A: The process of transcription starts as the DNA of a gene serves as a template for complementary…
Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?
A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…
Q: What is the effect of the insertion of a nucleotide in the 4th codon of the DNA sequence below?…
A: There are two strands of DNA :- template and coding strand . Template strand read in 3' to 5'…
Q: Determine what amino acid will be formed from the given DNA strand below:…
A: Determine what amino acid will be formed from the given DNA strand below:…
Q: Given the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write…
A: Nucleic acids are the essential macro molecules that carry and transmit genetic information in the…
Q: Which mRNA would be made if the sequence of the DNA coding strand is GAC? O GAC O GTC O GUC O CUG
A: Amino acids are organic compounds with amino and carboxyl functional groups as well as a side chain…
Q: Which three codons would code for a different amino acid sequence from that coded for by the mRNA…
A: Given: mRNA base sequence: AGU-UCA-CCA Have to determine which three codons will code for a…
Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…
A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…
Q: What will be the sequence of the single-stranded RNA transcribed from the following segment of…
A: Answer: TRANSCRIPTION : It is the process in central dogma in which single stranded RNA is formed…
Q: Given the following DNA strand, which of the following is its complementary MRNA? G GACIGATT"…
A: Transcription and translation are two processes of gene expression. The process of the formation of…
Q: Construct a polypeptide chain by translating the given red strand of the mRNA segment.…
A: Translation It is defined as the process of protein synthesis in which the sequence of mRNA is…
Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?
A: CAT CTA CAA ATA GCA CCT AAT TGT G (DNA)
Q: Give the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
A: DNA => Transcription => mRNA => Translation => Protein Given a sequence of DNA:…
Q: If a DNA sequence , 3' TAC AAT GAA 5' , is the template for transcription, the resulting mRNA would…
A: CENTRAL DOGMA:- The whole process of Central Dogma involves two processes:- 1) When DNA changes into…
Q: Illustrate the process of transcription by providing the correct bases for mRNA strand given the DNA…
A: Transcription is the process where the genetic information on the DNA strand is transferred into an…
Q: Given the following strand of DNA, find: 1. the complementary DNA strand 2. the mRNA 3. the TRNA 4.…
A: Gene is the segment of DNA (deoxyribonucleic acid) that is responsible for heredity and inheritance…
Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…
A: The information from the DNA is transferred to RNA by transcription. The information present in the…
Q: The first nucleotide in mRNA that will be synthesized from DNA below is: 3'-…
A: During the transcription process RNA is produced from the DNA within the nucleus of eukaryotic cells…
Q: If a sequence of mRNA is CUG AGU GCA, which of the following is the DNA segment from which it was…
A: DNA sequencing is defined as the way of determining the sequence of nucleic acid by identifying the…
Q: The sequence of part of an mRNA is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' What is the sequence…
A: Given mRNA sequence is 5'AUGGGGAACAGCAAGAGUGGGGC CCUGUCCAAGGAG–3' As we know that, Bases in DNA is…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: A DNA template strand having the sequence shown below would produce an mRNA molecule with that with…
A: DNA gets transcribed into mRNA by using RNA polymerase enzyme. mRNA is single stranded and DNA is…
Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…
A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. fiveGive the mRNA and amino acid sequence from this DNA strand: CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
- Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCTA strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?
- The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GUse the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash. Do not put a space in between characters so that LMS will recognize your answer. Message Strand +1 5-TAGTAGGCGGCATGTTTTCCCATACAGATGAAGGATAAACTCGTCT[x]TAT-3' [x]-cleavage site for CFI/CFII endonuclease (for RNA) Genetic Code: Second letter с A G UAUTyr UGC Cys UAC. UAA Stop UGA Stop UAG Stop UGG Trp CAUT CGU CAC His CGC CAA CGA Arg Gin CAGJ CGG AAU Asn AGU Ser AAC. AGC AAA AGA AAG Lys AGG Arg GAU GGU Asp GACJ GGC GAA GGA Glu GAGJ GGG] First letter כ A G U UUU UUC UUA UUGL CUU CUC CUA CUG AUU AUC lle AUA AUG Met GUU GUC Val GUA GUG Phe Leu Leu UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Gly DUAU DUAU DURO DURO A G Third letterin transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized RNA strand? Write the sequence from 5’ to 3’. What is the sequence of the template DNA strand? Write the sequence from 5’ to 3’.