73 Dicer catalyzes Sequence-dependent single-stranded RNA cleavage. Yes or no 74 Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions. A. noncoding b. long terminal repeat c. split gene D. enhancer 75 Which of the following cleaves the N-terminal methionine from polypeptides? A. Methionine isomerase b. Methionine aminopeptidase c. Methionine carboxylase D. Methionine transferas

73 Dicer catalyzes Sequence-dependent single-stranded RNA cleavage. Yes or no 74 Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions. A. noncoding b. long terminal repeat c. split gene D. enhancer 75 Which of the following cleaves the N-terminal methionine from polypeptides? A. Methionine isomerase b. Methionine aminopeptidase c. Methionine carboxylase D. Methionine transferas

Name: 73Dicer catalyzes Sequence-dependent single-stranded RNA cleavage.Yeso
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 73Dicer catalyzes Sequence-dependent single-stranded RNA cleavage.Yesorno74Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions.A.noncodingb.long terminal repeatc.split geneD.enhancer75Which of the following cle

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 29CTQ: A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that...

See similar textbooks

Similar questions

88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation. A.pre-initiation complexb.TF recognition elementc.pre-elongation complexD.TATA binding complex 89Which of the following is the GDP-GTP exchange protein?A.EF-Tub.none of the abovec.EF-TsD.EF-G 90RNA polymerase II has 14 subunits. Yesorno
28Elongation factor __________ reactivates arrested RNA polymerase II. A.TFIIEb.TFIISc.TFIIFD.TFIID 29Eukaryotic translation initiation proceeds through a ( ) mechanism. 30A variety of transcription ______________ factors helps to suppress transient pausing during elongation. A.terminationb.elongationc.none of the aboveD.initiation
91The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yesorno 92Core polymerase (α2ββ’) use intact double-stranded DNA as a template. Yesorno 93Protein synthesis machinery reads the mRNA nucleotide sequence in groups of three bases or ______________. A.operatorsb.codonsc.open reading framesD.operons
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.
mRNA maturation in eukaryotes includes all of the following EXCEPT: A. Topoisomerase activity B. Endonuclease C. 5’ 7’methylguanosine D. Polyadenylation E. snRNP function
49Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50Each bacterial mRNA open reading frame has its own ( ) codon. 51Two nuclear splicing intermediates resemble ______________. A.helicesb.lariatsc.hairpinsD.projections
Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
Match these transcription-associated terms with the appropriate definition or function. DNA sequence that will increase transcription of a eukaryotic gene А. Enhancer A. A sequence on a DNA strand that is similar to the transcript В. Coding strand Spliced, capped, and tailed. С. Mature eukaryotic MRNA recognize -35 and -10 sequences D. (0) factor of RNA polymerase Initiate transcription Е. RNA polymerase holoenzyme DNA sequence on the same molecule as a gene being studied F. Terminate transcription G. RNA polymerase Il with general transcription factors Н.
We have a eukaryotic full-length mRNA molecule consisting of 33 bp 5ʹ-...ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU...-3 a.which of the first 5 amino acid is translated b.Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.
An interesting phenomenon found in vertebrate DNAis the existence of pseudogenes, nonfunctional copiesof a gene found elsewhere in the genome. Some pseudogenes appear to have originated as double-strandedDNA copies of mature mRNA inserted into the chromosome; these copies later underwent mutations tomake them into pseudogenes.a. What sequence information might provide cluesthat the original source of some of these pseudogenes is cDNA copied in cells from mRNA andthen inserted into the genome?b. Would this mechanism of generating pseudogenesbe more likely to have operated if the pseudogenewas part of a gene family clustered in one region ofthe genome, or if it was instead part of a genefamily whose members are scattered around thegenome? Explain
Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?