Answered: 5. Why are typical bacteria and…

Science

Biology

5. Why are typical bacteria and cyanobacteria classified together in the Domain Bacteria? How do they differ?

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter25: Bacteria And Archaea

Section25.2: Prokaryote Reproduction And Evolution

Problem 5LO: State specific factors that contribute to the rapid evolution of bacteria and archaea.

See similar textbooks

Related questions

Q: What are two anatomical traits that are different between Adapoids and Omomyoids? A. An ear…

A: Two anatomical traits that are different between Adapoids and Omomyoids, which are early primate…

Q: These structures allow a bacterium to move through an aqueous environment: spores cilia flagella…

A: Microbes have evolved a wide range of specialised structures, such as spores, capsules, fimbriae,…

Q: You, a hospital administrator, are confronted by a news reporter who asks about an outbreak in your…

A: Here portrayed a critical epidemic of Clostridium botulinum, an anaerobic spore-forming microbes, in…

Q: Give the Steps, Enzyme/s involved, Electron carriers, ATP Generation, End product and significance…

A: Oxidative phosphorylation is a critical biological process that takes place in the mitochondria of…

Q: OXWTMA OU G K Т М А Q GKWTMAQC ++ + - ++ - - - - - + - + - + - - + - + - + + + - + + A cistron is…

A: In a complementation chart a group will contain similar mutations that failed to complement one…

Q: Give typed full explanation Which of the following results in the production of ATP from ADP? a.…

A: ATP is adenosine triphosphate which is the source of energy for the use and storage at the cellular…

Q: If a tortoise shell colored female cat is bred with a black male cat, what is the percentage of the…

A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: Based on the video, describe at least two lines of evidence that can be used to evaluate whether…

A: The classification of plesiadapiformes like Purgatorius as primates is a topic of ongoing debate in…

Q: fungus (which is, of course, a eukaryote, that is capable of both meiosis and sexual reproduction).…

A: Saccharomyces cerevisiae is a species of yeast, commonly known as baker's yeast or brewer's yeast.…

Q: Biochemical recognition systems within the stigma of a flowering plant prevent the pollen from a…

A: Reproductive isolation is characterised by the inability of a species to breed successfully with…

Q: A Health and safety are of the utmost importance in an early childhood institution. List the FIVE…

A: When designing and managing outdoor play areas within the context of early childhood education, it…

Q: Predictors of Eating Disorders Which of the following is the most important predictor of an eating…

A: Eating disorders are intricate battles within the mind. In these types of disorders, there is…

Q: In squirrels, the gray allele (G) is dominant to the brown allele (g) at the coat color locus. A…

A: The principle is the genetic variation in a poulation will remain constant from one generation to…

Q: Calculate the generation time given the following population data: Ro= 0.601, r = -0.05, Exlxmx =…

A: The generation time of a population is a key parameter in understanding its growth dynamics. It…

Q: 1. UV light damages DNA by the formation of pyrimidine dimers. Draw the detailed chemical structure…

A: Sometimes there are many accidental lesions formation occurs in DNA, These lesions are temporary…

Q: Match the label to the correct location on the corresponding image. Lower pitch Endolymph Oval…

A: The tympanic membrane is present between the outer ear and the middle ear. The basilar membrane…

Q: Punctate, errose, lobate, dry, convex, swarming, yellow, and circular are all terms that describe:…

A: Anabolism is a part of metabolism in which simple substances are formed from complex substances.…

Q: 4. Draw a cell in each of the following phases. Be sure to represent the major events of each phase…

A: Mitosis is the stage of the cell cycle in which newly formed DNA is separated and two new cells with…

Q: How can a skull of a specimen be classified as a Strepsirrhine?

A: Strepsirrhine are identified by their long snout and wet nose. This group includes lemurs and…

Q: An organism described as 2n=4 has the chromosomes below with genes indicated by letters and…

A: Chromosomal aberration - It is defined as the change in chromosome structure and number.Change in…

Q: Starting with the carbon in the glucose molecules, show how ONE glucose: 1) gets into the cell 2)…

A: Glucose is a six carbon molecule which is the fuel used for energy generation inside the living…

Q: the following pairings of organelle-function are mistaken loroplast - photosynthesis ell membrane -…

A: It is a sub unit with in a cell that performs a specific function. They are tiny organs and plays a…

Q: microbiota microbial antagonism transient parasitism opportunistic infections. resident commensalism…

A: The normal microbiota, composed of various microorganisms that inhabit the human body, plays a…

Q: Yeast cells grew from 19 to 54 kg dry cells m-3 in 7 hours. During this period 81 g of glycerol was…

A: In a bioprocess involving yeast cells, it is crucial to assess their growth and yield in relation to…

Q: Which of the following correctly matches the stage of cellular respiration with its location within…

A: A key metabolic process called cellular respiration takes place in the cells of all living things,…

Q: Please describe in detail what would be a suitable procedure should you break an Erlenmeyer flask…

A: Handling a broken Erlenmeyer flask containing a biosafety level 2 (BSL-2) microorganism inside a…

Q: carry the father’s genetic information

A: Genetic infromation refers to the informations which is stored in the DNA. DNA can code for proteins…

Q: Which of the following statements about the protein quality control system in the endoplasmic…

A: Endoplasmic reticulum is present in the cytoplasm, is a continuous membrane system consisting of…

Q: Of the three models of population growth, which is the most accurate depiction of a population in a…

A: The exponential model of growth describes the growth of a population in an environment as…

Q: A common soil fungal species is suddenly detected as an aggressive wheat pathogen, decimating crops…

A: Fungi are a group of microorganisms that belong to the kingdom Fungi. They are eukaryotic organisms,…

Q: Five loci defined by microarrays are known to contribute to meat quality in cattle. Premium meat…

A: You need to determine the possibility that the first offspring of a cow and bull cross would have…

Q: Determine whether Staphylococcus saprophyticus and Serratia marcescens are gram-negative or gram…

A: On the basis of the staining procedure called Gram staining, bacteria can be classified as gram…

Q: Convert daT NA TO CONA Commtur production Transformicol of Excherichia col HockBST co BST MANA from…

A: Cloning in genetics and genomics refers to the use of scientific methods to create identical, or…

Q: 1. Draw 8 phospholipid molecules arranged to show how the phospholipids will orient themselves on…

A: Phospholipids are the biomolecules that act as the main constituent of cell/plasma membranes.These…

Q: external lactose cell membrane on RNA polymerase promoter lactose permease B-galactosidase…

A: Genes that are connected to one another, such as those participating in the same metabolic process,…

Q: The neurotransmitter receptors. binds

A: These are neural chemical messengers that transmits signals between two neurons.

Q: Organelle Plasma Membrane Nucleus Mitochondria Smooth ER Rough ER Golgi Body Ribosome Lysosome…

A: The fundamental structural and operational unit of a living being is a cell. In accordance with the…

Q: Question 6 The pale-stained cells that can be seen on the section of the labia minora's mucosa are A…

A: The organs that produce and release substances that perform a specific function in our body are…

Q: Let S and s be the alleles for seed shape (spherical and wrinkled, respectively) in garden peas.…

A: Trait is a characteristic feature that is unique to a specific individual. Each trait is represented…

Q: fossil record that creates problems when scientists study primate evolution?

A: The fossil record is not a complete chronicle of every organism that has ever lived. Many animals,…

Q: otein? the mutation of a surface glu to an asp the mutation of an interior val to an ile the…

A: It is the clumping or misfolding of proteins. It can have adverse effects on the structure and…

Q: 2 What is the pathophysiology of trauma?

A: Trauma, in the context of medicine, refers to physical injuries or wounds caused by external forces.…

Q: Label the image to test your understanding of virus size relative to other microorganisms.

A: The microscopic infected agent that replicates only inside the living organisms and outside the…

Q: See image

A: The sequences are:AACGATGCCATCAGAGCCCAGGACGTGATTTAATTGCTACGGTAGTCTCGGGTCCTGCACTAAATT

Q: In the graph, what is the carrying capacity of the deer in this particular environment?

A: The species population size depends on various biotic and abiotic factors like adequate food,…

Q: The Swedish Botanist Carolus Liññáéus is recognized as the firs regarding the work of Linnaeus is…

A: Option 1: Linnaeus' work followed other Naturalists but his work was deemed unifying and so he…

Q: A solution is made using 1 mL of serum and 4 mLs of normal saline. Fill in the chart: a. Serum to…

A: Dilutions are laboratory processes where a quantity of one material is added to another to lower the…

Q: D Question 10 True or False: 3.0 moles of CO contains more atoms than 3.0 moles of Cl₂. True False

A: One mole is number of atoms which is approximately 6.022 x 1023 .

Q: PTS is associated with a: enzymes that are responsible for peptidoglycan synthesis inductive…

A: The Phosphoenolpyruvate: Sugar Phosphotransferase System, often abbreviated as PTS, plays a crucial…

Q: The amount of DNA in a differentiating oligodendrocyte in M-phase is 210pg. How much DNA would be…

A: The quantity of DNA within a cell changes during the cell cycle.The cell cycle is a highly…

Concept explainers

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.

Question

5. Why are typical bacteria and cyanobacteria classified together in the Domain Bacteria? How
do they differ?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Domain Bacteria

VIEW

Solution

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

17. The biological classification system categorizes organisms into which of the following domains? A) bacteria and eukarya B) prokarya and eukarya C) archaea and eukarya D) bacteria, eukarya and prokarya E) bacteria, archaea and eukarya
3. The following simple rules describe how to categorize living organisms into one of five kingdoms- Monera, Protoctista, Plantae, Fungi, Animalia. a) If the organism has no cell nucleus, then it's in the Monera kingdom (more commonly known as bacteria). b) If the organism does not fit into the above category, and it is single celled, then it is in the Protoctista kingdom (molds and algae). c) If the organism does not fit into either of the above categories, and it is photosynthetic, then it's in the Plantae kingdom (plants). d) If the organism does not fit into any of the above categories, and it has a nervous system, then it is in the Animalia kingdom (animals). e) Otherwise, if the organism does not fit into any of the above categories, it is in the Fungi kingdom (fungus). Construct a flowchart that uses this categorization scheme to determine the kingdom for a particular living organism. You may assume information about an organism can be acquired using functions: hasNucleus (0).…
2. What structural elements of bacteria are essential, their functions?
17. Which statement is true with regards to bacteria? Bacteria can be used to produce products such as beers and yogurts Bacteria can be used to clean up sewage and oil spills Bacteria recycle dead material to be used by plants and animals All of the following are true with regards to bacteria
1. Make a table to show the common characteristics used to group bacterial genera or species in the following groups and give one example of genus for each: (a) lactic acid bacteria, (b) coliforms, (c) proteolytic bacteria, (d) psychrotrophic bacteria, and (e) enteric pathogens.
1) Which cell shapes are observed in members of both Bacteria and Archaea? Which are unique to bacteria? Which to archaea?
What are bacteria?What is bacterial culture? How do grow bacteria?Why are there so many bacteria in my keyboard?
2) You isolate a strain of bacteria and want to know if it might be a new species. What do you need to compare it to?
1. Define and briefly describe the different classes of microorganisms (including the terms Eukaryotes and Prokaryotes): 1. Eukaryotes - a. Algae - b. Fungi - c. Protozoans - 2. Prokaryotes - a. Bacteria - b. Archae - Viruses - 3. 4. Prions - 2. Define the four main types of organic molecules. Be sure to describe their function and give examples of each a. Carbohydrates - b. Proteins - c. Lipids - d. Nucleic acids - 3. What does the term PPE stand for? What are common types of PPE that are worn in the lab or hospital setting? 4. Describe two ways in which microorganisms are used by us or by scientist/industry to improve our everyday lives. This is an applied microbiology question and answers should be directed towards this rather than normal function of microbes in the environment (including our gut microflora). 5. Identify two different types of staining techniques used with light microscopy. Describe the dyes used in these techniques and why they are used.
What are the 3 groups of bacteria based on their unique cell wall components.
Which of the following observations about a bacterium would distinguish it from the last eukaryotic common ancestor? A double-stranded DNA genome Lack of a membrane-bound structure surrounding the genome Fatty acids in the lipid bilayer of the plasma membrane Enclosed by a cell wall
5. There are numerous examples of both harmful and beneficial prokaryotes. Give specific examples of some prokaryotes that are harmful to human health and several that are beneficial to human health.