5. The Flemish breed of rabbits have an average weight of 3600 grams. The Himalayan breed has a mean of 1875 grams. Matings between these two breeds produce an intermediate F1 with a standard deviation of + 162 grams. The standard deviation of the F2 is ± 230 grams. Estimate the number of pairs of factors contributing to mature body weight of rabbits. Estimate the average contribution of each active allele.
Q: if you know the amino acid sequence of a protein can you predict with 100% certainty the DNA…
A: Codon is the genetic code that is formed by permutations and combinations of three nucleotide…
Q: Cirrhosis leads to scarring and increased hydrostatic pressure in the hepatic portal vein. Why do…
A: Liver glycogen serves as a glucose store that hepatocytes release when appropriate blood sugar…
Q: 2. What does the phylogenetic tree in Figure 2 indicate about the evolutionary relationships of the…
A: • Systematics – study of biological diversity in an environmental context (tracing phylogeny) •…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Calculate the CFU/mL of the original culture for the countable plate as shown in the diagram. b) How…
A: Introduction :- CFU( colony forming units ) are the count of cells present in orginal culture which…
Q: 3. You are surveying an area's rock layers using absolute dating. You have an element whose…
A: Absolute dating is a method used by geologists and archaeologists to determine the age of a…
Q: Question:- In terms of nerve action, describe 4 different molecular components involved. And for…
A: Movement of action potential along a nerve fiber in response to a stimuli is known as nerve action…
Q: What exactly does the phrase "FMS option" imply and what is its significance?
A: Exercise also aids in the reduction and alleviation of pre-existing health problems. Exercising…
Q: spoilage in canned foods
A: Spoilage is a form of substandard or process of spoiling, especially the decay or deterioration of…
Q: You have the following sequence reads from a genomicclone of the Drosophila melanogaster genome:Read…
A: An organism's genomic sequence is defined as the sequence of nucleotides that make up a DNA…
Q: As shown in Figure 13-14, what is the fundamental distinction between a pair-rule gene and a…
A: A pair-rule gene is a type of gene that plays a role in the creation of insect fragmented embryos.…
Q: What characteristic is considered as plesiomorphic? Explain your answer.
A: Introduction Plesiomorphy:- An ancestral or evolutionary trait that is shared by some or all members…
Q: f you have otoliths from two fish of the same species and they are the same shape but different…
A: In fish, otoliths are biomineralized ear stones that help in hearing and vestibular function. The…
Q: Bruno, a 48-year-old businessman, presents at the emergency room with a 12-day history of headache,…
A: * Given that Bruno has 12 days history of headache and myalgia, nausea, and vomiting. *His fever was…
Q: List some ways to prevent spoilage of canned food.
A: Prevention of canned food spoilage.
Q: In addition to anaerobic bacteria which other two examples did the narrator state that anaerobic…
A: Here I will give the two other conditions or states of anaerobic conditions.
Q: Premature-birth Risk Found Higher for Teens (reported in the Sacramento Bee, April 27, 1995, p. A7)…
A: Relative risk is defined as the comparative analysis of risks among two groups, namely the…
Q: 'Gamma-delta' T cells differ from 'alpha-beta' T cells by all of the following except O alpha-beta…
A: 'Gamma-delta' T cells differ from 'alpha-beta' T cells by all of the following except A. alpha-beta…
Q: Two particular contigs are suspected to be adjacent, possibly separated by repetitive DNA. In an…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: TERMS: Amino Acid Cholesterol DNA Hydrolysis Hydrogen Sugar Carbon Nucleotide Nitrogen Carbohydrate…
A: Relation between terms and process given :-
Q: Why coes the root grow between the leaf axil and internode?
A: Roots are the part of a plant that typically grows underground. They anchor the plant in the ground…
Q: Please define the term niche, and describe the many roles microbes fulfill in an ecosystem.
A: The niche of an organism is the purposeful function that it performs inside an environment. The area…
Q: What is the importance of the EMT during metastasis?
A: EMT is an evolutionary conserved developmental program which is implicated in carcinogenesis.
Q: Explain the mechanism by which action potentials are prevented from being propagated to a…
A: Action potential Is a shift in the resting membrane potential that is immediate, rapid, transitory,…
Q: Which of the following is not true of natural selection?(a) natural selection acts to preserve…
A: Natural selection is based on the evolutionary changes that occur within populations as a result of…
Q: Reproduction is usually secual with both male and female sexes, however asexual reproduction does…
A: Reproduction can be divided into two categories. One of the categories include asexual reproduction.…
Q: Which condition, aerobic or anaerobic, yields more energy (ATP) ?Why do you think this is ?
A: Respiration It is amphibolic and exergonic cellular process. Multistep enzymatic process. Metabolic…
Q: You have sequenced the genome of the bacteriumSalmonella typhimurium, and you are using BLAST…
A: A genome is an organism's whole genetic material. It is made up of genes and other elements that…
Q: 1. What is the function of DNA helicase in DNA replication? a. To create replication bubbles by…
A: Helicases are enzymes that catalyse the separation of duplex nucleic acids into single strands in an…
Q: what are the fundamental steps in canning?
A: The history of canning begins when Napoleon promised money to devise a way of preserving food during…
Q: Because of oxygen and nutrient requirements, cells in a tissue must reside within 100 μm of a blood…
A: Mammalian cells require nutrients and oxygen to survive, so they are found within 100 to 200 mm of…
Q: Draw a diagram showing what pGEM will look like after it has been digested with BamHI. Be sure to…
A: Answer
Q: Subject: Biopharmaceutical technology 1.Identify the types of water that are available and widely…
A: USP (US Pharmacopeia) is a designation that ensures that the water is purified and can be used in…
Q: Need Answer in short upto 4-10 lines only and need ASAP . Thanks
A: Proteins are macromolecules that comprise one or more long chains of amino acid residues
Q: all of the following that are true regarding viruses? Oncogenic viruses stimulate uncontrolled host…
A: All that are true regarding viruses - Answer - 1. Oncogenic viruses stimulate uncontrolled host…
Q: 1. How do demographic factors affect population size? 2. Are the effects of these factors mutually…
A: Demography is the statistical and mathematical study of the size, composition, and spatial…
Q: Why are urinary tract infections such common healthcare-associated infections? Conduct additional…
A: Answer
Q: A two-month-old baby is found to lack class I MHC molecules. How would this defect impact his…
A: A large locus present on vertebrate DNA known as the Major Histocompatibility Complex (MHC), has a…
Q: what animal is fastest ? A canadian goose B humming bird C monarch butterfly
A: canadian goose is fastest than humming bird and monarch butterfly . Humming bird is fastest than…
Q: You are performing an experiment with liquids on your backyard. One morning, you observed that the…
A: INTRODUCTION Gene code is the sequence of nucleotides in DNA and RNA that codes for particular amino…
Q: specific strategies used by health professionals patients, and the general public to prevent…
A: Antibiotics are the drugs(medicine ) used to treat the bacterial infection. There are so many…
Q: What are some of the advantages and disadvantages of utilizing insects as experimental animals in…
A:
Q: To live on a large planet with strong gravity, a cold, dry climate, and a thin atmosphere, what…
A:
Q: In an investigation of fruit fly behavior, an enclosed choice chamber was used to test whether the…
A: A spatial distribution is a graphical representation of a phenomenon's distribution throughout the…
Q: I1. Electrical impulses in muscle fibers are called 12. Groups of muscle fibers are that are…
A: The movement of skeleton muscles is voluntary in nature and regulated by central nervous system.…
Q: Identify the probable causes of spoilage in canned food
A: Probable causes of canned food spoilage.
Q: In Mendel's genetic experiments many characteristics of the plants were quantified, such as their…
A: Mendel uncovered the fundamental laws of heredity. His experiments demonstrated that the inheritance…
Q: Because of the naturally-existing regulation mechanisms of the cell, injecting double- stranded RNA…
A: Usually the RNA is single started molecule. It is synthesized with the help of template DNA and it…
Q: Describe the common mode of reproduction in Angiosperms
A: The reproductive parts of a flower are represented by the stamens and pistils. It is made up of a…
Q: A. Tongue rolling (T) is dominant over non-tongue rolling (t). Right handedness (R) is dominant over…
A: Dear student as per Bartleby policy i can only solve first one part. The image attached below is the…
please answer all with complete solution/explanation
Step by step
Solved in 2 steps
- 6. You are studying the physiology of hypertension (high blood pressure) using the rat as a model system and wish to breed a strain of rat which has naturally high blood pressure. Systolic blood pressure is a quantitative trait with a continuous phenotypic distribution. It is measured as millimeters of mercury displaced in a blood pressure meter (mm Hg). You start with a base population of normal domestic rats, which has a mean systolic blood pressure of 120 mm Hg. You select the 10% of the rats which have the highest systolic blood pressure. The average systolic blood pressure value of these selected breeders is 140 mm Hg. You then interbreed the selected rats and measure the systolic blood pressure in their progeny. What would be the average systolic blood pressure in the progeny of the selected breeders if A. heritability = 0.5 ? B. heritability = 1.0 ? C. heritability = 0 ? D. In a second experiment, you go back to that same base population of domestic rats and select the 10% of…5. When two alleles are observed independently in a phenotype is called multiple alleles. Human blood group ABO is a good example of multiple alleles. The three alleles are: I^, IB, i. Mother's blood type is AB (IAIP) and father's blood type is B (1³i). Provide the genotype and phenotype ratios using the Punnett square given below. Genotypes 6. When the allele of a trait is found on X or Y chromosome, it becomes sex-linked. The results differ from males to females. One such example is of red green colorblindness. The mother is a carrier (XCX), and the father is colorblind (XY). Provide the genotype and phenotype ratios using the Punnett square given below. Genotypes Phenotypes **CLUSTROS Phenotypes 75-102426. Snow geese (Chen caerulescens) come in two color types, white “snows” and “blues” with dark bodies. A single gene controls coloration, where the dark (“blue”) allele (D) is dominant. A population of 30,012 geese includes 9236 dark individuals. Genetic testing reveals that 7636 of the 9236 dark individuals are heterozygous (Dd). What is the actual frequency of allele D? 0.819 0.181 0.435 0.347
- 1. A selection experiment was carried out on a population of field mice in the lab had a mean hematocrit of 65. The mice used to create the next generation had a mean hematocrit of 50. Once the offspring from that experiment reached adulthood, the experimenters measure a mean hematocrit of 58. Answer the following questions using this information a). What is the narrow sense heritability for hematocrit in these mice? Show all work b).Using those results, what would be the predicted hematocrit in the offspring population after another generation of selection where only mice with a mean hematocrit 10 points below the parental mean were allowed to breed. Show all work c). Would you expect the narrow sense heritability for a wild population of field mice in Iqaluit to be the same ? Explain.1. In a population of 1000 bison, there are two alleles at the B locus. It acts incompletely dominantly, so that you are able to figure out each animal's genotype simply by observing its phenotype. How convenient. You find 665 BB, 225 Bb, and 110 bb bison. a) What are the allele frequencies of B and b? (round off the number) b) Using the allele frequencies, what numbers (not just fractions, but numbers of actual bison in this population of 1000 and yes you can round off) would you expect to be BB, Bb, and bb? c) Do you think this bison population is in HW equilibrium? d) No matter what your answer to c, if they weren't in HW equilibrium, name 5 possible reasons why.1. In a wild strain of tomato plants, the phenotypic variance for tomato weight is 3.2g². In another strain of highly inbred tomatoes raised under same environmental conditions, the phenotypic variance is 2.2 g². With regard to wild strain a. What is VG b. What is h₂² C. Assuming that all of the genetic variance is additive what is h²
- 5. There is a helpful shortcut for calculating the probability of genotypes resulting from a dihybrid cross (or any cross considering two or more pairs of alleles) that does not require drawing a very large Punnett square. This is done by first determining the probabilities of each trait alone (using a monohybrid cross) and then using the multiplication rule to combine the probabilities of all the genotypes being considered. Using our TtYy plants above, we would first assign each set of alleles to its own Punnett square as follows: I t Y y T TT Tt Y YY Yy t Tt tt y Yy УУ a. Based on the Punnett squares above, what is the probability of being genotype tt in this cross? b. Based on the Punnett squares above, what is the probability of being genotype YY in this cross? c. Using the probabilities that you just calculated for the genotypes tt and YY, what is the probability of one offspring being both genotype tt and YY in this cross (use the multiplication rule)? d. What is the probability…1. For a single locus with two alleles, A₁ and A₂: (a) Draw a graph (using graph paper) showing both the frequency of A₁ A2 heterozy- gotes and A₂ A₂ homozygotes, at Hardy-Weinberg frequencies, as functions of p (the frequency of A₁). Note that both p and the genotype frequencies should have values between 0 and 1. (b) Find the value of p above which A₁ A2 genotypes are more common than A₂42 genotypes. You can solve this algebraically, or estimate it from your graphs. 2. Consider three loci, A, B, and C, each with two alleles, with the frequencies of A₁, B₁, and C₁ all being We look at a population and find that there are four distinct haplotypes, shown here, each with a frequency of: A₁ B1 TT A1 C₁ B1 A₂ B₂ AT C₂ A₂ B₂ C₁ C₂ Of the three pairs of loci (AB, AC, and BC) which pair(s) are in Gametic Equilibrium (D = 0) and which are in Gametic Disequilibrium (D ‡0)? [Hint: Consider each pair separately, ignoring the other locus. For example: for the BC pair, consider the four…1. Consider this graph on running speed in huskies Midosspring running speed (m/s) 16 14 12 10 8 + 2 Husky running speed 4 6 8 Midparent running speed (m/s) 10 12 14 16 a. Approximately what is the heritability of running speed in this kennel of huskies? (You can approximate by eyeballing from the graph, no need to calculate the actual slope) b. If the breeder where to selectively breed the dogs, will the dogs run substantially faster in the next generation? c. What else can the breeder do to increase running speed?
- 25. List the three alleles for blood: 26. List the genotypes for blood: 27. List the phenotypes for blood: 28. A type of chicken shows codominance with black (B) being codominant with white (B'). The heterozygous condition is checkered. Cross a checkered rooster with a white hen. Show the following: Genotypes: Phenotypes: Genotypic Ratio: Phenotypic Ratio:3. Set up a Punnett square using the following information: Dominate allele for purple corn kernels = R Recessive allele for yellow corn kernels =r Dominate allele for starchy kernels = T Recessive allele for sweet kernals =t Cross a homozygous dominant parent with a heterozygous parent. Using the Punnett square above: a. What is the probability of producing purple, starchy corn kernels? Possible genotype(s)? b. What is the probability of producing yellow, starchy corn kernels? Possible genotype(s)? c.What is the probability of producing purple, sweet corn kernels? Possible genotype(s)? d. What is the probability of producing yellow, sweet corn kernels? Possible genotype(s)?eritance / 13 of 15 Black hair color is dominant to white hair color in mice. Interpret the Punnett squrare below to determine the expected phenotypic ratio for the offpring of a homozygous black mouse and a white mouse. В Bb Bb Bb Bb O A. 4 Black: 0 White O B. 3 Black: 1 White O C 2 Black: 2 White O D. O Black: 4 White acer