5. The DNA sample in your final vial contains numerous strands of DNA ( 46 chromosomes from EACH cell lysed; and we hope hundreds of cells were lysed). Despite having all of this DNA present in your vial with the Master Mix, only one specific portion of your DNA will be amplified ; which part? How are we able to locate and copy just this region instead of accidentally copying other regions of DNA ?

5. The DNA sample in your final vial contains numerous strands of DNA ( 46 chromosomes from EACH cell lysed; and we hope hundreds of cells were lysed). Despite having all of this DNA present in your vial with the Master Mix, only one specific portion of your DNA will be amplified ; which part? How are we able to locate and copy just this region instead of accidentally copying other regions of DNA ?

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 2VCQ: Figure 14.14 You isolate a cell strain in which the joining of Okazaki fragments is impaired and...

See similar textbooks

Similar questions

2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 1) САСТС ССAGT GTACC T 3) GGAGT CAATC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCCGA G 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…
2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GCTTG G 12) TGCTT GGAGT (a} Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…
3. In the following drawing, the top strand is the template DNA, and the bottom strand shows the lagging strand prior to the action of DNA Polymerase I. Three Okazaki fragments are shown and the RNA primers (asterisks) have not yet been removed. 3'- -5' 5********** RNA primer Left Okazaki fragment ↑ RNA primer ↑ -||- Middle Okazaki fragment -||- *********** RNA primer Right Okazaki fragment -3' A. Which Okazaki fragment was made first, the one on the left or the one on the right? B. Which RNA primer would be the first one to be removed by DNA polymerase I, the primer on the left or the primer on the right? For this primer to be removed by DNA polymerase I and for the gap to be filled in, is it necessary for the Okazaki fragment in the middle to have already been synthesized? Explain why. C. Let's consider how DNA ligase connects the left Okazaki fragment with the middle Okazaki fragment. After DNA polymerase I removes the middle RNA primer and fills in the gap with DNA, where does DNA…
1. TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand. b) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can continue the synthesis of the new strand.
4. (2 points) Pseudomonas aeruginosa's circular chromosome is 7.5x106 bp long and the replication fork in Pseudomonas aeruginosa moves at a constant 1000 nt/s using bidirectional replication. Approximately how long will it take a P. aeruginosa to replicate its own genome?
1. The image shown in Figure 1 below represents a strand of DNA following replication. The black lines present above the top and below bottom strands of DNA represent the phosphodiester backbone of the molecule. Examine the DNA strands and locate any sites that are damaged, mismatched, or otherwise require repair. Indicate where in the strand the specific lesion is located, and provide a detailed overview of the post-replicative repair process that would likely be used to rectify the lesion. Assume that each lesion, even those that are located in close proximity will be repaired separately. CH, CH, OCH, CH, OCH₂CH, GATCCGAATCGGCTAGGATCGGCATCCGATTCGATCGGCATCCGATCGCTAGCO CH, CH, CH, CH, CH, TACGATCGATC CTAGGATTA CCGACCCTAGCCGTAGGGTAACGTAGCCGTAGGCTAGCGACCGGGGATGCTAGCTAG Figure 1: Graphical Representation of a strand of dsDNA containing errors and damage following replication
5. The nucleotide sequences of the DNA molecules in the figure below were obtained from four different individuals, one wild type and three mutants. Wild Type 5'-TTATCCATGATCGGATCGATCCATTAGCCGA-3' 3'-AATAGGTACTAGCCTAGCTAGGTAATCGGCT-5’ Mutant I 5'-ATCCATGATCGGATTGATCCATTAGCCGAAT-3’ 3'-TAGGTACTAGCCTAACTAGGTAATCGGCTTA-5’ Mutant II 5'-CCGTTATCCATGATCGGATAGATCCATTAGCC-3’ 3'-GGCAATAGGTACTAGCCTATCTAGGTAATCGG-5’ Mutant III 5'-CACCGTTATCCATGATCGGAACGATCCATTAGC-3’ 3'-CAGGCAATAGGTACTAGCCTTGCTAGGTAATCG-5’ a) Identify the open reading frames in each sequence of DNA and translate them into proteins. Write down the sequence of amino acids that will be obtained after translation: b) Which of the mutations above would be least likely to cause a change in the function of the protein? Why? c) Which of the mutations above would probably cause a major disruption in the function of the protein? Why?
3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and amplified in Ion Torrent sequencing. The beads with different kinds of fragments will be loaded into different wells. The following graphs show the first forty (40) signals from two different wells. The value of one (1) in the y-axis of the graph corresponds to incorporation of one (1) nucleotide to every DNA strand on a bead. (a) You can observe that in every single step the signals are not the multiples of an integer. Explain why such signals are produced and how we can interpret the signals. (b) Using the first forty (40) signals shown below, please figure out the DNA sequence of the fragment attached to the bead in each well. (c) Based on the sequences of the fragments, can we guess the partial sequence of the original DNA sequence (before fragmentation)? If so, what could it be? (d) In the well #1, when the non-zero signals will show up after the 40 steps? Answer this by the step…
3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and amplified in Ion Torrent sequencing. The beads with different kinds of fragments will be loaded into different wells. The following graphs show the first forty (40) signals from two different wells. The value of one (1) in the y-axis of the graph corresponds to incorporation of one (1) nucleotide to every DNA strand on a bead. (a) You can observe that in every single step the signals are not the multiples of an integer. Explain why such signals are produced and how we can interpret the signals. (b) Using the first forty (40) signals shown below, please figure out the DNA sequence of the fragment attached to the bead in each well. (c) Based on the sequences of the fragments, can we guess the partial sequence of the original DNA sequence (before fragmentation)? If so, what could it be? (d) In the well #1, when the non-zero signals will show up after the 40 steps? Answer this by the step…
several options can be correct Consider the following segment of DNA, which is part of a linear chromosome: LEFT 5’.…TGACTGACAGTC….3’ 3’.…ACTGACTGTCAG….5’ RIGHT During RNA transcription, this double-strand molecule is separated into two single strands from the right to the left and the RNA polymerase is also moving from the right to the left of the segment. Please select all the peptide sequence(s) that could be produced from the mRNA transcribed from this segment of DNA. (Hint: you need to use the genetic codon table to translate the determined mRNA sequence into peptide. Please be reminded that there are more than one reading frames.) Question 6 options: ...-Asp-Cys-Gln-Ser-... ...-Leu-Thr-Val-... ...-Thr-Val-Ser-... ...-Leu-Ser-Val-... ...-Met-Asp-Cys-Gln-...
5. After extracting your DNA from your cheek cells, we will add a solution called Master Mix to your DNA sample. One important component of the Master Mix are the "oligonucleotide primers" (or "primers" for short). What is the importance of these primers to the PCR process? 6. How did Taq DNA polymerase acquire its name? What is the job of this enzyme? Why aren't we using human DNA polymerase? briofly summarize in
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.